Media
Lysogeny Broth (LB)33 composition was triptein 10 g/L (Britania), NaCl 5 g/L (Ciccarelli), and yeast extract 5 g/L (Britania). When required agar 1.5 g/L (Britania) was included.
Strains and constructions
The strains used in this study are reported in Table S1. The promoter region of the blsA gene was amplified using primers blsA_EcoRI_FW (5′- GAATTCagtattacaaattgaacgtgt -3′) and blsA_BamHI_REV (5′- GGATCCaagacttccgtgaaatataaa -3′). Primers were purchased at Integrated DNA Technologies, USA. High-fidelity polymerase chain reaction products were digested with EcoRI and BamHI enzymes (Promega) and cloned into the corresponding sites of pLPV1Z harboring the promoterless luxABCDE genes34. The correct construction was verified by sequencing, and pLPV1Z-PblsA::luc was subsequently introduced into A. baumannii V15 strain by transformation.
Light settings
Samples were exposed to blue light emitted by nine-LED (light-emitting diode) arrays with an intensity of 6 to 10 µmol photons/m2/s and peak emission centered at 462 nm 8. Light intensity was measured using a radiometer/photometer (Flame-T, OceanOptics). Temperature was set at 23 °C, and fluctuations in the incubator were less than 0.5 °C.
Zeitgeber (i.e., “time giver” or entraining agent) time 0 or ZT0 (9:00 am) indicates the time at which lights were turned on. Circadian Time (CT) refers to a specific time in the free-running conditions (constant darkness, DD, and constant temperature of 23 °C). Photo and thermal conditions were controlled with an I-291PF incubator (INGELAB, Argentina), and temperature was monitored using DS1921H-F5 iButton Thermochrons (Maxim Integrated, USA).
Luminescence assays
For all assays, A. baumannii cells were cultured in white 96-well plates (Greiner) under static conditions in LB broth (250 µl for well) from an initial OD660 of 0,05. Plates were sealed with a transparent optical film (ThermalSeal RT2RRTM, EXCEL Scientific) to avoid evaporation and contamination, and the seal over each well was perforated twice to avoid condensation and allow oxygen exchange. Cultures were exposed to light-darkness cycles (12 h blue light (bL) and 12 h dark (D)) for 4 days, after which the cultures were released to constant darkness (free-running condition). All experiments were carried out in temperature-controlled incubators (I-291PF incubator, INGELAB, Argentina). The temperature was kept constant at 23 °C. Temperature fluctuations in the incubator due to lights being on or off were less than 0.5 °C. The luminescence of each well was integrated for 10 s every 30 min (Berthold Centro LB 960 microplate luminometer, Berthold Technologies). Microwin 2000 software version 4.43 (Mikrotek-441 Laborsysteme) was programmed to leave the plate outside the luminometer after each recording to expose A. baumannii cells to the environmental cues. It should be noted that blue light is not expected to affect luciferase activity measurement, since blue light application is spatially and temporally separated from luciferase emission detection. In fact, bioluminescence was measured inside the luminometer equipment, while the plate was ejected between readings, for exposure to blue light.
For phase-shift assays, cells were entrained for 3 days under a bLD cycle and then were subjected to a phase shift caused by a 6-h night extension. After 1 (or 3) more days under regular bLD, cells were released into constant darkness conditions.
For free-running (FR) assays, cells were exposed for 10 days to constant darkness conditions.
In all cases, 1 sample = 1 well of a 96-well plate.
The presence of biofilms was assessed qualitatively, by eye, as a pellicle forming at the air-liquid interface in the well. Also, pellicles and wall biofilms were quantified as described in the Biofilms assays item below.
Analysis of FRP following 4 days of entrainment with bLD cycles
In all cases, the first 24 to 36 hours of recording were removed due to accumulation of the luciferase enzyme. Raw data were analyzed using CircaLuc v0.7, a Shiny application developed in our laboratory for the analysis of periodic luminescence data, freely available at https://ispiousas.shinyapps.io/circaluc/44,45. CircaLuc linearly detrends and smooths luminescence signals (with adjustable parameters), estimates the circadian period using the Lomb-Scargle (LS) periodogram (via the Lomb R package)46, with an oversampling of 30. The acrophase (time at peak) and amplitude of each signal were estimated using the Cosinor method by fitting a cosine waveform to the data using a non-linear least squares regression implemented through the NLS function of base R, with R² used to evaluate the goodness of fit. The data is shown as mean ± SD of luminescence. Periods were considered as circadian when their duration was between 18 and 33 hours. Background signals from the bacteria transformed with the empty luc-plasmid or LB broth alone were at least 10 folds of magnitude lower than signals retrieved from the strains expressing luc directed from the blsA promoter.
Under bLD conditions, any luminescent signal of a sample with a period of 24 h and an R2 adjustment ≥ 0.5 was considered to be “synchronized”. In the case of DD conditions, any luminescent signal with a period range between 18 and 33 h and an R2 adjustment ≥ 0.5, which had previously synchronized to the bLD cycle, was considered to be “rhythmic”. We considered “entrained” samples to be those rhythmic samples whose acrophases in FR conditions had a difference of less than 3 h with respect to that of the entrainment conditions. To avoid confusion, the following nomenclature is used in this work: “percentage of synchronized” means the number of synchronized samples over the total number of samples tested; “percentage of rhythmic under DD” means the number of rhythmic samples over the total number of samples tested; and “percentage of entrained” represents the number of entrained samples over the number of rhythmic samples.
Analysis of FRP in the absence of entrainment
For data shown in Fig. 5 and Fig. S6, data analysis of the period was performed using Fast Fourier Transform, nonlinear least squares function of the BioDare2 suite47, only for samples that passed the Jonckheere-Terpstra-Kendall (JTK) cycle test for rhythmicity (P < 0.01) on nonnormalized, baseline detrended data. The P values were corrected using the Benjamini-Hochberg procedure for multiple testing. Periods were considered circadian when their duration was between 18 and 34 hours.
Plotting data
Graphs were generated using either GraphPad Prism software version 8.0.1 or the ggplot2 package in R version 4.4.348. Final figures were generated using Biorender (https://app.biorender.com/).
Bacterial cultures for RNA extraction
A. baumannii V15 cells were cultured in 24-well microplates under static conditions in LB broth at 23 °C from an initial OD660 of 0,05. The bacteria were incubated for 4 days under 12 L/12D photoperiod and then released to constant darkness. 2 ml samples were retrieved at the selected timepoints indicated in the text and figures. The samples were centrifuged, and the pellets were saved at -80 °C until further use.
RNA extraction
RNA was extracted following procedures described in Muller et al., 201713. Briefly, pelleted cells were mixed with 0.5 ml of lysis buffer (0.1 M sodium acetate, 10 mM EDTA, 1% SDS) in a boiling-water bath. Cell lysates were extracted three times at 60 °C with one volume of phenol, which was adjusted to pH 4.8 with 50 mM sodium acetate, and then once with chloroform at room temperature. The RNA precipitated overnight at -20 °C with 2.5 volumes of ethanol was collected by centrifugation, washed with 70% ethanol, and dissolved in diethyl pyrocarbonate (DEPC)-treated deionized water at 65 °C. RNA quality and quantity were evaluated by gel electrophoresis and by determination of the relationship of absorbance at 260 nm to absorbance at 280 nm.
Gene expression analysis via RT-qPCR
Total RNA (0.5 µg) was treated with RQ1 RNase-free DNase (Promega). First-strand cDNA synthesis was performed using random priming and Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV; Invitrogen). PCR was performed in an AriaMx thermal cycler (Agilent Technologies, Santa Clara, CA, USA) using SYBR Green I to monitor double-stranded DNA synthesis. Normalized relative quantities (NRQ) of blsA were obtained using the qBase method49 with recA and rpoB as reference genes for normalization across samples. The qPCR reactions were performed the primers V15blsA.rtF 5’CCTGTGTTATGCCAGCCAACGAA3’ and V15blsA.rtR 5’ TCAACGACCTCTTGTTCGCCTTCT3’ for blsA; rpoBrt.F 5’CAGAAGTCACGCGAAGTTGAAGGT3’ and rpoBrt.R 5’AACAGCACGCTCAACACGAACT3’ for rpoB; and recAF.rt 5’TACAGAAAGCTGGTGCATGG3’ and recAR.rt 5’TGCACCATTTGTGCCTGTAG3’ for recA15. The stability of the normalizers across all samples was determined by calculating the coefficient of variation (CV) of their NRQs. Both reference genes showed CVs below 25% (0.237 for rpoB and 0.249 for recA), which is within the accepted range for stably expressed reference genes. Melting curve analyses at the end of the process and ‘no template controls’ were performed to ensure product-specific amplification without primer-dimer artifacts.
Biofilm assays
For biofilm assays, a dilution in fresh LB broth to OD660 = 0.05 of an overnight shaking culture grown at 37 °C of each strain of interest medium was inoculated into 96 96-well plate. The cultures were then incubated for 4 days statically in 12bLD:12D photocycle (LD4), and a 5th day in DD (DD1) at 23 °C. Wall biofilms, i.e., biofilms that form in the liquid-plastic interphase, were visualized and quantified by crystal violet staining (Fig. S1 A and B), as described in Mussi et al., 20108. Briefly, the supernatant of each well at each condition (n = 5) was aspirated and rinsed thoroughly with distilled water. Then, a 0.1% crystal violet solution was added and incubated for 1 hour, after which the wells were rinsed again thoroughly with distilled water. The biofilms attached to the tube walls were visualized and photographed, and then solubilized using an 80:20 ethanol–acetone solution. The OD580/OD660 ratio was used to normalize the amount of biofilm formed to the total cell content of each sample tested to avoid variations due to differences in bacterial growth under different experimental conditions. Pellicles that formed on the culture surfaces at the air-liquid interphase were detected by visual inspection. Also, to estimate pellicles on the liquid surfaces, the culture medium was removed gently with a Pasteur pipette without losing pellicles. The cells that remained in the tubes were resuspended in 1 ml of sterile phosphate-buffered saline (PBS) solution, and the cell density was determined by measurement of OD660. The amount of biofilm formed by each sample was normalized to its total biomass, which was determined by measuring the OD660 of the whole culture in each well (Fig. S1 C)8.
Statistics and reproducibility
All statistical analyses were carried out using Prism 8 software version 8.4.3. Normality was checked using the Shapiro-Wilk test. When data were normally distributed, means between two groups of values were compared using the two-sample Student’s t-test or paired t-test, and two-way ANOVA was used to compare the means between more than two groups. When the assumption of normality was not met, Wilcoxon rank sum test, Wilcoxon signed-rank test or the Watson-Wheeler test for homogeneity of angles were employed. Chi-square test was performed to compare proportions. Results were considered significant at 5% significance level. The exact sample sizes (“n” values) as well as the number of biologically independent experiments are indicated in the figure legends. Luminometry experiments involved sample sizes (n) ranging from 11 to 60, and 2 to 3 biologically independent experiments. RT-qPCR, biofilm formation, and growth experiments involved sample sizes (n) ranging from 3 to 5, and 3 biologically independent experiments.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.