Subcellular localization of NnWOX1-1 and NnDREB2C transcription factors
The pCAMBIA1300 vector containing green fluorescent protein (GFP) was used as the overexpression vector, and GFP fusion expression was employed to identify “positive” transgenic plants. The full-length CDS of NnWOX1-1 and NnDREB2C were cloned, and then inserted into the pCAMBIA1300 vector. The positive plasmid was then transformed into Agrobacterium tumefaciens GV3101 (Weidi Biotechnology Co., Ltd., Shanghai, China). After verification by PCR method, bacterial cultures containing the target genes were obtained. Single colony was selected and cultured overnight to prepare the tobacco leaf infection solution. The pCAMBIA1300 vector carrying an empty plasmid was used as the control. The bacterial suspension containing the pCAMBIA1300 vector with the target gene was used to infect Nicotiana benthamiana leaves aging 35–45 days. Before infection, the tobacco plants were exposed to strong light for 10 min to promote stomatal opening. A 1 mL syringe was used to draw the infection solution, and the abaxial side of the tobacco leaves (avoiding the veins) was infiltrated. After 2–3 days of dark cultivation, the infiltrated epidermal tissue was sampled and examined under a super-resolution laser confocal microscope (LSM 880NLO, Carl Zeiss, Germany) to observe GFP fluorescence signals.
Vectors construction of NnWOX1-1 and NnDREB2C transcription factor
For the overexpression vector construction, the laboratory had previously successfully constructed the NnWOX1-1 overexpression vector and preliminarily validated the gene’s function in Arabidopsis [27]. For the NnDREB2C overexpression vector construction, the cloning vector harboring the target gene and the overexpression vector pCAMBIA1300 were subjected to double digestion with BamHI and XbaI.
restriction enzymes. Following digestion, DNA fragments of the desired size were excised from the agarose gel and purified using a commercial DNA gel extraction kit. The purified target fragment and the linearized vector backbone were ligated using T4 DNA ligase at 16 °C for cohesive-end assembly.
The ligation product was transformed into chemically competent E. coli (DH5α) cells, which were subsequently plated onto LB agar supplemented with 100 µg/mL ampicillin (1‰ Amp). After overnight incubation at 37 °C, single colony was inoculated into LB liquid medium containing ampicillin, and incubated with shaking (37 °C, 12 h). For confirmation of correct assembly, the recombinant plasmid was re-digested with BamHI/XbaI, and the restriction pattern was analyzed. Final validation was performed through full-length sequencing by Nanjing Qingke Biotechnology Co., Ltd.
For the RNAi vector construction of NnWOX1-1 and NnDREB2C, the RNAi interference fragment was derived from a partial nucleotide sequence spanning the coding region and the 3′ untranslated region (UTR). The forward primer sequences of NnWOX1-1 were: upstream, 5′-GGGGTACCAAGGAGACTGAGGTGCCGAA-3′; downstream, 5′-CGGGATCCATGTAAGCTTCACCCATTAA-3′. The reverse primer sequences were: upstream, 5′-GCGTCGACAAGGAGACTGAGGTGCCGAA-3′; downstream, 5′-GCTCTAGAATGTAAGCTTCACCCATTAA-3′. The forward primer sequences of NnDREB2C were: upstream, 5′- GGGGTACCGCCTTAGAGC.
TGCCGGAGTG − 3′; downstream, 5′- CGGGATCCATATATATAATATTTACAAT − 3′. The reverse primer sequences were: upstream, 5′- GCGTCGACGCCTTAGAGCT.
GCCGGAGTG − 3′; downstream, 5′- GCTCTAGAATATATATAATATTTACAAT − 3′. The cloning vector containing the target gene and the overexpression vector pCAMBIA1300 were subjected to double digestion with BamHI and XbaI restriction enzymes. The digestion products were separated by agarose gel electrophoresis. The desired gene fragment and linearized vector were excised from the gel and purified using a commercial DNA gel extraction kit. The purified target fragment and digested vector were ligated with T4 DNA ligase at 16 °C for 16–18 h. The ligation mixture was transformed into chemically competent E. coli (DH5α) cells and plated onto LB agar supplemented with 100 µg/mL ampicillin (Amp). After overnight incubation at 37 °C, individual colony was selected, and then inoculated into LB liquid medium containing 100 µg/mL Amp for culture with shaking (200 rpm) at 37 °C for 12 h.
Plasmid DNA was extracted from the cultures and verified by Sanger sequencing to confirm correct insert orientation and sequence integrity. Recombinant plasmids were transformed into E. coli (DH5α), and “positive” clones were selected for amplification. Colony PCR was performed to validate successful insertion, followed by plasmid extraction and sequencing. The confirmed recombinant plasmids (NnWOX1-1 and NnDREB2C overexpression and RNAi constructs) were introduced into Agrobacterium tumefaciens GV3101 via freeze-thaw transformation. Transformed colonies were screened by colony PCR to confirm plasmid integration. Validated Agrobacterium strains were stored at − 80 °C for subsequent plant transformation experiments.
Transient transformation of NnWOX1-1 and NnDREB2C in lotus root and S. trifolia
Preparation of materials of lotus root and S. trifolia
Lotus seeds and S. trifolia corms of similar size were selected, and the plumules of lotus and S. trifolia buds were used as tissue culture materials. After rinsing the surface mucus with clean water, the materials were disinfected with 75% alcohol, and then soaked in sterilized water with Shannong No. 1 Type I for 12 h. Subsequently, these materials were inoculated onto MS medium (containing 30 g/L sucrose, 7 g/L agar, 0.15% Shannong No. 1 Type III, 1 g/L activated charcoal, pH 5.8) and cultured aseptically for one month. Tissue culture seedlings of lotus and S. trifolia with similar growth vigor were selected for infection experiment.
The steps of instantaneous transformation
The recombinant plasmids of the NnWOX1-1 and NnDREB2C overexpression vector and RNAi vector were transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. Subsequently, the plasmids were introduced into lotus root (Nelumbo nucifera) and S. trifolia following the protocol. The Agrobacterium strains carrying the pCAMBIA1300 empty vector, overexpression vectors and RNAi vectors were activated on YEB solid medium (containing 50 mg·L⁻¹ kanamycin and 50 mg·L⁻¹ rifampicin). Single colony was selected, and subcultured on fresh YEB solid medium for expansion. Colonies were collected into a 50 mL centrifuge tube, resuspended in 20 mL YEB liquid medium, and incubated overnight at 28 °C with shaking at 200 rpm. The overnight culture was centrifuged (5 min, 6000 rpm, 4 °C), and the supernatant was discarded. The pellet was resuspended in 2 mL MES buffer (20 mM MgCl₂ + 10 mM MES), centrifuged again under the same conditions, and the supernatant was discarded. The pellet was resuspended in 1 mL MS medium, and then transferred to a sterile 50 mL tube, adjusted to 20 mL with MS medium, and supplemented with 200 µL acetosyringone (AS, 20 mg/mL). The suspension was incubated overnight at 28 °C with shaking (200 rpm) until the OD₆₀₀ reached 0.7–0.9. Sterilized lotus root and S. trifolia seedlings were wounded at internodal regions and immersed in the Agrobacterium suspension for overnight infection. Infected plants were transferred to MS liquid medium (MS + 3% sucrose + 20 mg/L AS, pH 5.8), and cultured in a growth chamber under the following conditions: 28 °C/12 h (day) and 22 °C/12 h (night), with a light intensity of 30,000 lx. After 5 days, infected plants were rinsed three times with sterile water, and the medium was replaced. Three days later, plants were washed 3–5 times with cefotaxime solution (400 mg/L) to eliminate residual Agrobacterium. Plants were transferred to fresh MS liquid medium (MS + 3% sucrose + 300 mg/L carbenicillin, pH 5.8), and maintained in the growth chamber under the same conditions.
Identification of “positive” transgenic seedlings
The leaves, stems, roots, and nodes of the transformed plants were selected for identification of “positive” plants. Confocal fluorescence microscopy was used to observe the eGFP green fluorescence in both overexpression and interference vectors. Additionally, real-time quantitative PCR was also employed to detect “positive” seedlings. For PCR identification, the extraction of RNA and synthesis of the first strand of cDNA followed the same method as described above. The upstream primer sequence for NnWOX1-1 was 5′-TCCTCAGCAATGGCGAAGAACG-3′, and the downstream primer sequence was 5′-TCGGCACCTCAGTCTCCTTCTC-3′. The upstream primer sequence for NnDEEB2C was 5′- GCAACAGACCGTCAGAC.
CATCC − 3′, and the downstream primer sequence was 5′-GGATTGTCATCTCAC.
CACGGAAG-3′. β-actin was used as the internal reference, with the upstream primer sequence 5′-GACTCTGGTGATGGTGT-3′ and the downstream primer sequence 5′-CACTTCATGATGGAGTTGT-3′. The PCR reaction system (20 µL) included: 0.8 µL each of upstream and downstream primers, 10 µL of 2× ChamQ SYBR qPCR Master Mix, 2 µL of cDNA template (200 ng/µL), and 6.4 µL of ddH2O. The PCR protocol comprised 40 cycles: 30 s at 95 °C (initial denaturation), followed by 10 s at 95 °C (denaturation), 30 s at 60 °C (annealing/extension), and a final melt curve analysis step (30 s at 95 °C, 60 s at 60 °C, and 15 s at 95 °C).
Identification downstream gene regulated by NnWOX1-1
Yeast one-hybrid
NnWOX1-1-pGADT7 was employed as bait to screen a yeast one-hybrid motif library. Following identification of “positive” clones through auxotrophic selection, DNA sequencing and multiple sequence alignment (Clustal Omega) revealed motifs interacting with NnWOX1-1. Three plasmid combinations included pGADT7-NnWOX1-1, pGADT7-NnWOX1-1 + pHIS2-p53, pGAD53m + pHIS2-p53 were independently transformed into Y187 competent cells and plated on SD/-Trp/-Leu selection medium. After 3–5 days incubation at 30 °C, six colonies were subjected to colony PCR verification. Three randomly selected clones were pooled, normalized to OD600 = 0.002, and serially diluted (0, 10, 20, 30, 40, 50, 75, and 100 mM) for spot assay on 3-amino-1,2,4-triazole (3AT)-supplemented plates. For library screening, Y187 cells pre-transformed with NnWOX1-1-pGADT7 were co-transformed with motif library plasmids, and plated on SD/-Trp/-Leu/-His medium containing 100 mM 3AT. “positive” clones from 100 mM 3AT SD-TLH plates were submitted to Nanjing Ruiyuan Biotechnology Co., Ltd. for sequencing. Consensus motif sequences were subsequently mapped to the Nelumbo nucifera genome using BLASTn tool to retrieve full-length candidate gene (NnDREB2C).
EMSA binding assay validation
The electrophoretic mobility shift assay (EMSA) for protein-DNA interaction was conducted by Nanjing Ruiyuan Biotechnology Co., Ltd. The NnWOX1-1 was expressed and secreted using the Pichia pastoris secretory expression system, followed by purification and quantification via the BCA method. A biotin-labeled DNA probe was synthesized based on a specific sequence fragment of NnDREB2C (CAATTCTGTTCTCAAATTATCTCTCCTCTCCCAACAGCGTCACCTTATCCACGTGGGAAACGTCAACCAAACGAC). The interaction between NnWOX1-1 and NnDREB2C was further validated via a series of experimental steps, including 4% native polyacrylamide gel electrophoresis (PAGE), electrophoretic transfer to a nylon membrane, membrane washing, and chemiluminescent detection of probe-protein binding signals.
Cloning of NnDREB2C
The seeds of Space Lotus 36 were dehulled and soaked in sterile water for germination. Following seed sprouting, total RNA was isolated from the leaves of lotus seedlings, and cDNA synthesis was carried out using a commercial cDNA synthesis kit according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, US). Primers of the NnDREB2C were designed with Primer 5.0 software based on the published lotus genome sequence, and subsequently synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences were as follows:
Forward primer: 5′-CGGGATCCATGGGGAAGGGAGAGAAGAGG-3′,
Reverse primer: 5′-GCTCTAGACTAGGAATCCCAACCCAAAATATC-3′. The PCR amplification reaction (50 µL total volume) consisted of: 25 µL of 2× Phanta Flash Master Mix, 2 µL each of forward and reverse primers (10 µM), 2 µL cDNA template. Nuclease-free water was used to adjust the final volume. Thermal cycling conditions included: 98 °C for 30 s for initial denaturation, 35 amplification cycles of 98 °C for 30 s, 66 °C for 5 s, 72 °C for 5 s. Final extension was 72 °C for 1 min. PCR products were purified and sequenced by Nanjing Qingke Biotechnology Co., Ltd.
Expression profiling analysis of NnDREB2C
Seeds of Space Lotus 36 were dehulled and germinated in sterile water. Uniformly sized seedlings were selected and treated for 3 days with a solution containing 200 mg/L ethephon (An ethylene-releasing agent, ethephon is typically a solid that release ethylene under certain conditions), 20 µL auxin, and 20 mg/L sucrose. After treatment, seedlings were transferred to fresh water for continued cultivation. Hypocotyl tissues were selected at 0 h, 18 h, and 36 h post-transfer. Total RNA was extracted using the method described in previous protocols. To investigate tissue-specific expression patterns, samples were collected from internodes, leaves, seeds, petioles, and flowers of lotus. Reverse transcription of total RNA was performed using HiScript® III RT SuperMix. For qRT-PCR of NnDREB2C, primers were designed as follows: Forward: 5′-GCAACAGACCGTCAGACCATCC-3′, Reverse: 5′-CGGATTGTCATCTCACCACGGAAG-3′. β-actin was used as internal standard.
Forward: 5′-GACTCTGGTGATGGTGT-3′, Reverse: 5′-CACTTCATGATGGAGTTGT-3′. The qPCR reaction mixture (20 µL total volume) included: 10 µL 2× ChamQ SYBR qPCR Master Mix, 0.8 µL each of forward and reverse primers, 2 µL cDNA template, 6.4 µL RNase-free ddH₂O. PCR reaction program was 40 cycles of 94 °C for 30 s, 95 °C for 5 s, 60 °C for 60 s. Relative mRNA levels were calculated using the 2–ΔΔCtmethod. All experiments included three biological replicates to ensure reproducibility.
Determination of ethylene and auxin content
Measurement of ethylene content in transgenic plants
NnWOX1-1 and NnDREB2 overexpression and RNAi plants were thoroughly rinsed with distilled water, and the plant materials were weighed. The samples were promptly placed into 50 mL glass vials, which were immediately tightly sealed and stored in a foam box to avoid light for 7 h. Prior to sample analysis, 500 µL of a 0.5 × 10−6 mol/L ethylene standard was drawn using a 1 mL gas-tight microsyringe, and injected into a gas chromatograph (GC-7890 A, Agilent, USA) for measurement. The samples were analyzed only after the peak height of the standard ethylene stabilized. The GC conditions were as follows: 45 °C, 120 °C and 200 °C of column temperature, injector temperature, and FID detector temperature respectively; column head pressure flow rate was 40 mL/min with 2.8 mL/min column flow rate, and makeup gas flow rate was 2.5 mL/min; split ratio was 10:1, and injection volume was 500 µL. Ethylene release rates was calculated according to following formula: Ethylene concentration (µL/L) = (sample peak height/standard ethylene peak height) × standard concentration. Ethylene release rate [nL/(g·h)] = [ethylene concentration (nL/L) × container volume (mL)]/[fresh weight of sample (g) × sealing time (h)].
Measurement of IAA content in transgenic plants
The overexpression and RNAi lines of NnWOX1-1 and NnDREB2B were washed in clean water before endogenous hormone determination. Empty vector-infected lines were used as controls. 0.5 g of freeze-dried sample was ground in liquid nitrogen, and powder was transferred to 2.5 ml centrifuge tubes. A total of 500 µl extraction buffer (isopropanol: water: formic acid = 2:1:0.002) was added, followed by incubation at −20 °C for 20 min. These tubes were treated with ice-water bath sonication for 30 min. After adding 1 ml chloroform, the samples were incubated at −20 °C for 20 min, and then sonicated in ice-water bath for 5 min. The tubes were vortexed for 1 min, and centrifuged at 13,000 rpm for 5 min at 4 °C. The lower layer (900 µL, collected in two aliquots of 450 µL each into 1.5 ml centrifuge tubes) was freeze-dried. The residue was redissolved in 200 µl 80% methanol, followed by ice-water bath sonication for 1 min and vortexing for 1 min. The solution was filter-sterilized and 100 µL was transferred to insert tubes. IAA content was determined using liquid chromatography (Sigma, Shanghai, China) reported by Li et al., (2022).
Ethylene treatment
The coat of lotus root seeds was cracked and soaked in distilled water for germination. After germination, a sterile blade was used to make incisions at the hypocotyl of the seedlings. Interference vectors of NnWOLX1-1 and NnDREB2C were introduced into the lotus plants via Rhizobium rhizogenes-mediated transformation, which was followed with previously described method. Transgenic plants were treated with 300 mg/L ethephon for 48 h, and then transfered to distilled water for cultivation. The number and length of adventitious roots were measured 10 days later.
Determination of root number and length of transgenic plants
The overexpression and interference vectors were introduced into seedlings. Tissue sections were prepared, mounted on glass slides, and examined for eGFP green fluorescence using a confocal laser scanning microscope. Additionally, the relative gene expression level in “positive” seedlings was quantified by real-time quantitative PCR (qRT-PCR), and the data was analyzed and visualized using GraphPad Prism. For both the transgenic and control groups, about 6 eGFP-“positive” seedlings with comparable growth vigor were selected. The number and length of adventitious roots exceeding 1 mm were measured, and the mean values were calculated and recorded.
Analysis of fresh weight and dry weight in transgenic plants
After measuring the fresh weight of transgenic and control plants using an analytical balance, the samples had been oven-dried at 65 °C until the weight were not changed. Their dry weight was then measured to calculate the dry matter content, with averages determined.
Data analysis
The experimental data were analyzed using one-way ANOVA in GraphPad Prism 9, and bar graphs were generated. The results represent means ± SE from three independent biological experiments, and each with more than ten plants. Statistical significance was indicated as follows: “* ”represents p < 0.05; “** ”represents p < 0.01; “*** ” represents p < 0.001; “****” represents p < 0.0001.