Eevee and its Evolutions synergize brilliantly in Pokémon Trading Card Game Pocket decks, and the Wisdom of Sea and Sky expansion gives us new ways to continue evolving our strategy with this lovable line of Pokémon. For this deck list and strategy, we’re putting the focus entirely on Eevee’s Psychic-type Evolutions, which means it’s Espeon ex and Sylveon ex’s time to shine.
2× Eevee (Wisdom of Sea and Sky)
2× Espeon ex (Wisdom of Sea and Sky: Lugia)
2× Sylveon ex (Eevee Grove)
1× Espeon (Eevee Grove)
1× Sylveon (Eevee Grove)
2× Eevee ex (Eevee Grove)
2× Professor’s Research (Promo)
1× Silver (Wisdom of Sea and Sky: Ho-Oh)
1× Cyrus (Space-Time Smackdown: Palkia)
1× Sabrina (Genetic Apex: Charizard)
2× Poké Ball (Promo)
1× Red Card (Promo)
1× Eevee Bag (Eevee Grove)
1× Giant Cape (Space-Time Smackdown: Dialga)
Game plan: This deck benefits from being flexible, meaning your focus isn’t strictly around setting up with a specific Pokémon in mind—Eevee and each of the Evolution Pokémon included have roles to play. Wisdom of Sea and Sky’s Eeveecan put a random Pokémon in your deck into your hand with its Find a Friend move, and with some luck it might even help you find your Stage 1 Pokémon promptly. Eevee ex gives you the potential to fill the battlefield with even more of Eevee’s Evolutions with its Veevee ’volve Ability, and it can attack with Bite in a pinch.
Sylveon ex has recently become a popular choice in competitive decks for its Happy Ribbon Ability, which allows you to draw two cards once during your turn when you play Sylveon ex from your hand to Evolve one of your Pokémon. Coupled with Eevee’s Find a Friend, Happy Ribbon will draw through your deck quickly, amplifying your options for what to do next.
Espeon ex and Sylveon ex can both do decent damage with their attacks, but it’s their Abilities that make them a powerful pair in play. Espeon ex’s Psychic Healing Ability is a consistent source of healing for your Pokémon as long as Espeon ex is in the Active Spot. Since Psychic Healing can target any of your Pokémon, you might choose to heal damage from a Benched Pokémon, saving it from being a target for Cyrus. It can come in handy against Pokémon with Abilities that do damage, too, such as Darkrai ex and Greninja. With Psychic Healing, Espeon ex can also heal itself to tank attacks from powerful Pokémon that might otherwise be able to knock it out in one hit. Oricorio’s Safeguard Ability, which prevents damage from Pokémon ex, is still prominent in competitive play, so many players opt to include non-ex Pokémon in their decks to circumvent it. Despite not being Pokémon ex, Espeon and Sylveon still bring plenty of utility to this deck strategy. Espeon’s Energy Crush attack packs a powerful punch if your opponent has an abundance of Energy in play. And Sylveon can become this deck’s most reliable attacker once you start getting Evolution Pokémon onto your bench—its Evoharmony attack can do a whopping 130 damage for just two Energy if you have three Benched Evolution Pokémon!
The Eevee Bag Item card is a notable Trainer in this deck for its ability to either boost the damage of attacks by or heal damage from your Pokémon that evolve from Eevee. This deck’s strategy of drawing through cards quickly could leave you vulnerable to Supporter cards like Mars, so the new Silver Supporter card is a must include to disrupt your opponent’s own Supporter options—perhaps even sending their Mars back into their deck before it can wreak havoc on your strategy.
Mind the battlefield as you plan your next move, and have fun, Trainers!
NASA has begun assembling the Space Launch System (SLS) rocket that will send humans on a lunar landing mission in 2027.
The buildup has begun at Kennedy Space Center (KSC) in Florida with the shift of the SLS engine section and boat tail, which protects the engines during launch, from the Space Systems Processing Facility to the Vehicle Assembly Building (VAB). The VAB already contains the almost complete Artemis II SLS, which is set to launch in early 2026 and carry a crew on a ten-day mission around the Moon.
Artemis III, in 2027, is the landing mission, and planners are aiming for the lunar South Pole.
There are plenty of ifs and buts around the mission. Artemis III could be the final flight of the SLS, depending on what happens to NASA’s budget. In one proposal, the SLS program is canceled after the Artemis III mission. An amendment could, however, keep the program running for a few more missions.
Then there is the question of how the astronauts will get down to the lunar surface. The current plan involves a rendezvous with SpaceX’s Starship Human Landing System, but the last three test flights of SpaceX’s Starship have not gone well, and the most recent rocket exploded before it even left Earth. Musk’s rocketeers, therefore, have their work cut out if they are going to meet NASA’s 2027 requirement.
No pressure on making a success of the upcoming Starship test flight.
The engine section of the SLS is currently lacking the former Space Shuttle Main Engines, which are due to be shipped from NASA’s Stennis Space Center in early 2026. The rest of the Artemis III SLS core stage is at NASA’s Michoud Assembly Facility in New Orleans. It includes the liquid hydrogen tank, liquid oxygen tank, intertank, and forward skirt.
The SLS core stages for Artemis I and II were previously manufactured entirely at the Michoud facility before being transferred to NASA Kennedy for integration with the solid rocket boosters (SRBs), upper stage, and the Orion crew spacecraft. Some parts of the process were shifted to Kennedy to “streamline” the process and, according to NASA, “enable simultaneous production operations of two core stages.”
That is, unless Artemis III ends up using the final SLS – if cancellations and cuts bite. ®
Nearly 400 killed, over 6,900 rescued in latest spell of monsoon rains in Pakistan
ISLAMABAD: Nearly 400 people have been killed and over 6,900 rescued during the latest spell of monsoon rains in northern Pakistan that began late last week, officials said on Tuesday, as the government launched a nationwide survey to assess damage to homes and infrastructure.
The National Disaster Management Authority (NDMA) said of the 400 deaths since Friday, 356 were killed in Khyber Pakhtunkhwa (KP) alone, a mountainous northwest province hit by cloud bursts, flash floods, lightning strikes and landslides in the deadliest downpour of this year’s monsoon season.
In total, 670 Pakistanis have perished in this year’s monsoon season that began on June 26.
Addressing a joint news conference on Tuesday, Pakistan’s army and government spokesmen and the chief of the NDMA said coordinated relief and rescue operations had been stepped up in affected parts of KP and the mountainous Gilgit-Baltistan (GB) region.
“Currently, there are eight units of the infantry and eight units of the FC [frontier constabulary] directly involved in search and rescue and flood relief operations,” Director General Inter-Services Public Relations (ISPR), Lt Gen Ahmed Sharif Chaudhry, told reporters in Islamabad.
“In the search and rescue work, 6,903 of children and adults have been rescued by the army units,” the army spokesman said, adding that over 6,300 people had also received medical treatment.
Chaudhry said logistics bases had been set up in Kanju and Daggar to supply food, tents and medicines, while helicopters were flying emergency aid to remote areas.
Information Minister Ataullah Tarar said 70 percent of the region’s power supply had also been restored, including in districts like Buner, Shangla, Swat and Bajaur, where electrical grids, poles and transformers were destroyed.
He said ministers for energy, communications and Kashmir affairs were deployed in the field to monitor relief operations.
“In Malakand division, the N-90 highway has been fully reopened after clearing all blockades,” Tarar added.
More than 1,200 tents, 3,000 kilograms of medicines and 40 tones of food rations have been dispatched to the flood-hit regions, with over 500 medical camps operational in the area.
Chairman of the NDMA, Lt Gen Inam Haider Malik, who also addressed the news conference, confirmed that the death toll from this year’s monsoon stood at around 670 while at least 25,000 people had been rescued in total in the last four days.
He warned of continued risks from localized flooding and cloudbursts in KP, GB, and northern Punjab, with a new monsoon spell expected in the last week of August.
“A complete survey has been launched, which has been started to assess the damage of houses and public infrastructure,” Malik said, adding that its findings would be ready by early September.
Malik said more than 50 percent of landslides had been cleared and Prime Minister Shehbaz Sharif had approved a special ration package for affected districts.
Aid convoys to Swabi, Buner, Malakand, Bajaur, Shangla and Swat were also underway, with support from military formations and non-governmental organizations.
“All arms of the state are mobilized in this national response,” he added.
TRAVEL ADVISORY
Separately, the NDMA issued a travel advisory on Tuesday warning of road closures and damage in the country’s north due to floods and landslides.
According to the advisory, tourists have been told to avoid travel on vulnerable stretches of the Karakoram Highway and connecting routes, including Torghar, Batagram, Shangla, Lower Kohistan, Tattapani, Gilgit and Hunza.
Road blockages due to floods and landslides were reported at several points on the Karakoram Highway, as well as at multiple locations along the Mingora–Swat road.
The NDMA also listed a number of damaged or closed bridges and roads in Gilgit-Baltistan, Skardu, Ghizer, Hunza and Astore.
“Surmo Bridge, Ghanche: damaged; no alternate … Baghecha, Skardu: damaged; alternate: temporary causeway but unsafe,” the advisory said.
It added that the Astak Bridge on the Jaglot–Skardu road was partially open, while major routes such as Shandur, Ishkoman, Gulmit in Gojal, Hoper in Nagar, and the Skardu–Kargil road in Kharmang district were closed with no alternate routes available.
The advisory urged travelers to check updates regularly and avoid unnecessary movement in the affected areas until roads are cleared and safe for traffic.
PUNJAB ALERT
The Punjab Provincial Disaster Management Authority (PDMA) on Tuesday also issued a fresh alert for heavy monsoon rains across much of the province from Aug. 19–22.
“Severe thunderstorms are forecast in most districts, including Rawalpindi, Murree, Galiyat, Attock, Chakwal, Jhelum, Gujranwala, Lahore, Gujrat and Sialkot,” the PDMA spokesperson said, adding that downpours were also expected in Dera Ghazi Khan, Multan and Rajanpur.
PDMA Director General Irfan Ali Kathia said all commissioners and deputy commissioners had been directed to remain on alert in line with instructions from Punjab’s chief minister. He warned of rising water levels in rivers and streams, flash flooding in hill torrents, and the risk of urban flooding in major cities.
“Citizens are urged to adopt precautionary measures during bad weather,” Kathia said. “Stay in safe places during storms, avoid unnecessary travel, and keep children away from low-lying areas and electricity poles and wires.”
The DG added that health, irrigation, communications, local government and livestock departments had all been placed on high alert. In case of emergency, people were advised to call the PDMA helpline at 1129.
Our Honor Magic V5 review is coming up, and we’ve already completed several of our in-house tests, including the battery life and charging components.
The international version of the Magic V5 is equipped with a trendy Silicon-Carbon battery boasting a 5,820 mAh capacity (vs. 6,100 mAh on the Chinese model) and comes with 66W wired charging support. The phone did not disappoint when it comes to endurance, securing an Active Use Score of 11 hours and 52 minutes.
The result positions the Magic V5 ahead of the Samsung Galaxy Z Fold7 and Huawei Mate X6 and in the same ballpark as the Google Pixel 9 Pro Fold. We also see a noticeable step up from last year’s Magic V3.
We also ran the tests on the external display with the main one folded. The V5 scored similar Active Use scores to its predecessor, but with different proportions, including noticeable gains in the calls and gaming components.
Moving on to the charging test, Magic V5 showed some competent speeds and completed a full charge in exactly 53 minutes. The phone was sitting at 36% after 15 minutes on the charger and reached 67% at the half-hour mark.
These results place the Magic V5 in the right behind key competitors like the Oppo Find N5 and vivo X Fold3, which boast faster 80W and 120W charging support.
Australia’s Foreign Minister Penny Wong. File.
| Photo Credit: AP
Australia’s foreign minister on Tuesday (August 19, 2025) criticised Israel for revoking visas held by Canberra’s diplomatic representatives to the Palestinian Authority.
Israel’s tit-for-tat move followed Australia’s decision on Monday evening to block a far-right Israeli politician from the country ahead of a speaking tour.
Australia and Israel have been increasingly at odds since Canberra declared it would recognise a Palestinian state at the UN General Assembly in September.
Australian Foreign Minister Penny Wong said revoking the diplomats’ visas was an “unjustified reaction” by Israel.
“At a time when dialogue and diplomacy are needed more than ever, the Netanyahu Government is isolating Israel and undermining international efforts towards peace and a two-state solution,” she said in a statement.
Israeli Prime Minister Benjamin Netanyahu hit back on Tuesday, slamming his Australian counterpart Anthony Albanese as “a weak politician who betrayed Israel and abandoned Australia’s Jews”.
The Australian government on Monday cancelled the visa of far-right Israeli politician Simcha Rothman, whose ultranationalist party is in Netanyahu’s governing coalition.
Rothman had been scheduled to speak at events organised by the Australian Jewish Association.
Hours later, Israel’s Foreign Minister Gideon Saar said he had revoked the visas of Australia’s representatives to the Palestinian Authority.
“I also instructed the Israeli Embassy in Canberra to carefully examine any official Australian visa application for entry to Israel,” he said.
“This follows Australia’s decisions to recognise a ‘Palestinian state’ and against the backdrop of Australia’s unjustified refusal to grant visas to a number of Israeli figures.”
Sony is finally ready to take on the likes of SteelSeries, Razer, and Logitech with its InZone brand of PC gaming accessories. While InZone started with monitors and headsets in 2022, with a few new products since then (including its great InZone Buds and the sleek but pricey M10S OLED), Sony is making a concerted effort to take over your desk. It just launched two new headsets, a gaming keyboard, a wireless mouse, and even a couple of mousepads, all developed alongside esports organization Fnatic, and all available for preorder today.
As you might expect, Sony’s not aiming for the bargain bin here. Each of these peripherals is made for competitive play, and they come with high prices that don’t always feel justified.
To test them all out at once, I swapped out each of my regular PC peripherals for the new InZone gadgets, which made me feel like I was on a Sony Pictures movie set with intense product placement.
The headband size adjusters are one of my favorite new features in the H9 II. It’s the small stuff, right?Image: Sony.
The InZone H9 II gaming headset is the successor to the bulkier H9 from 2022, with a refined finish, a handful of improvements, and a gen-to-gen price hike from $299.99 to $349.99. The headset is slimmer and lighter (273g versus 330g), and it features a clever “pinch-to-adjust” button on each side of its headband to let you easily find the right fit. The suspended headband design feels lightweight on my head, rivaling the most comfortable models I’ve used, like the SteelSeries Arctis Nova Pro Wireless.
The new model has the same 30mm speaker drivers as Sony’s latest WH-1000XM6 flagship headphones. Even though they’re 10mm smaller than those in the previous-gen model, they sound just as phenomenal for music as they do for games. You’re also getting fantastic active noise cancellation, with the option to turn on a transparency mode that, notably, doesn’t affect the audio quality. You can customize the H9 II’s more granular settings within the company’s InZone Hub on PC or via Bluetooth in Sony’s Sound Connect mobile app — the same one used for several of its consumer headphone models.
This headset has several features every wireless model should have. The ear cups are on swiveling hinges, giving you the option to let them rest on your chest between matches, or if you need to remove them to talk in person. You can now listen to audio via a 3.5mm cable, even when the headset is out of battery. Wired mode will override any wireless connections. If you’d prefer to go wireless, it can maintain simultaneous connections over Bluetooth and its compact 2.4GHz USB-C transmitter, which has a toggle for PC and “other” platforms.
The headset works just fine with the PS5 and Switch 2, letting me listen to podcasts from my phone as I play. This model adds Bluetooth LE Audio support, allowing them to last longer per charge with better sound — love that, especially since I’m likely to keep them paired to two devices. Another new feature for this generation is a feature that several other headsets have: a removable boom microphone, in case you’d rather use a desktop mic or if you’re heading outdoors.
The $149.99 InZone E9 wired in-ear monitors are small and lightweight, with good noise isolation. They’re simple to use, either connecting via 3.5mm jack or its included 3.5mm-to-USB-C dongle, which is required to personalize the audio in the InZone Hub app. Unlike normal earbuds, these and all other in-ear monitors have hooks that route the cables on top of your ear cartilage and down the back of your ears, so as to stay out of your face. It all ships in a nice case that springs open when unzipped, exposing several ear tip size options.
The E9 in-ear monitors are tuned for FPS games out of the box. The default equalizer setting gives a flat, reference-style sound that pursues accuracy over bombast — the better to locate footsteps and gunshots in game. It’s effective, but outside of gaming, I found the E9s boring to listen to compared to the full-bodied, warm sound of the Linsoul KZ ZSX in-ear monitors that I bought on Amazon for about $60. That Linsoul model is the best-sounding set of headphones that I own — with detachable cables, no less — and I never expected to pay so little for something so good. Perhaps you’ll be as inspired as I was by our 2019 piece on great Chinese hi-fi to find other options that are significantly cheaper, yet better-sounding than Sony’s new IEMs, at least for non-gaming needs.
The InZone E9 comes in black or white.Image: Sony
Sony is one of the only major companies making gaming in-ear monitors, along with Razer, which makes the Moray (those have detachable cables and are $20 cheaper) but I hope it aims higher, and future models sound better than the cheaper competition.
To type all of this, I’ve been using Sony’s InZone KBD-H75, a name so clunky that I’m just going to refer to it as the InZone keyboard. This wired milled-aluminum board took the place of my split ergo gaming keyboard made by Kinesis Gaming, which I use to manage wrist strain during and after work. So, this wasn’t a swap that I was exactly looking forward to for ergonomic reasons. However — forgetting my wrists for a moment — it feels nice to type on, once I got used to the 75 percent layout that omits several navigation keys I commonly use.
The KBD-H75 uses Hall effect magnetic switches that actuate faster and more accurately than mechanical switches. I’m accustomed to clicky Cherry MX Blue switches, and I found the InZone keyboard doesn’t have quite enough resistance for my taste. In fact, they’re so easy to press that I kept accidentally actuating keys in chat apps, making it look like I fell asleep at my desk. This can be rectified by customizing the actuation point of each key, between 0.1mm and 3.4mm. It’s a feature that’s common among its competitors. And thankfully, you won’t need to install the InZone Hub app to make adjustments; Sony took a page from other keyboard makers by building a web version of its app that can be accessed from any PC this keyboard is plugged into — perfect for tournaments or LAN tournaments.
Thanks to the milled-aluminum case and gasket-mounted switchplate, I couldn’t sense vibrations as I pounded out articles and messages. Tapping each key results in a quiet yet satisfying sound, and I know my partner wishes my split ergo was this quiet. But, again, I prefer switches that have a little bit more resistance. I’m sure if I were a professional gamer, I’d be happier with these.
Ask most people who are into keyboards and they’ll probably tell you a handful of alternatives with similar features to the InZone keyboard that cost less than the $299.99 Sony’s asking for. At this price, most gamers expect wireless support and hot-swappable switches. The $169.99 LemoKey P1 HE has hot-swappable Hall effect switches, plus 1000Hz polling over 2.4GHz wireless. Unless Sony’s design and its promise of 8,000Hz polling rate are really doing it for you, there are many good options out there that cost less.
The top and sides of the keyboard are aluminum but the bottom is plastic.Image: Sony
I’m dubious of this keyboard’s 8,000Hz polling rate, which is one of its selling points (as well as one of the mouse below). Instead of being limited to 1,000Hz, which means it can register your input once per millisecond, 8,000Hz increases the rate to register movement and clicks once every 0.125ms. Sony’s definitely not the first company to advertise 8,000Hz polling in a gaming peripheral, but its utility is just as questionable here as it is in other products. As it turns out, human reaction time is pretty slow, so, maybe you shouldn’t pay more for this feature.
I’ve been radicalized by Rocket Jump Ninja’s video on YouTube, which demonstrates that 1,000Hz is more than enough speed for most people; in the video, it shows that even fast human reaction times are still over 150ms, or approximately 6.67Hz. So, unless you have superhuman reflexes, this feature just isn’t necessary. Plus, trawling through Reddit shows that some gamers have had issues with an 8,000Hz polling rate affecting game performance.
Lastly, there’s the InZone Mouse-A — Sony’s first wireless gaming mouse. It costs $149.99, and at 48 grams, it’s the lightest mouse that I’ve ever used. This right-handed mouse is light on flourishes and excess buttons, with just a left and right click, two thumb buttons, the scroll wheel, and a profile-switching button on the bottom. As someone who typically uses the Glorious Model I, I quickly warmed up to its soft, matte-textured arch, though I wish it had a thumb rest. It feels pretty similar to the Logitech G Pro X Superlight in terms of ergonomics. I have an average-sized hand, though small-handed gamers will also likely find this to be a comfortable pick. The click is swift and relatively quiet, and it has optical switches (as many gaming mice do at this point), letting inputs register faster than they would with mechanical switches.
The purple PCB viewable through the covered honeycomb pattern looks pretty slick.Image: Sony
To complement its new mouse, Sony has launched two cloth mousepads, both of which are 18.89 x 15.7 inches in size. The Mat-F is thicker at 6mm (versus 4mm), with a surface that’s meant to create some drag to prevent the mouse from moving any more than you want it to. It’s designed for tactical first-person shooters that don’t emphasize twitchy movement. It costs $59.99. The $34.99 Mat-D, is for those who want speed, and the ability to make quick flicks of the mouse to pull off headshots and other commands. I don’t typically use any kind of mousepad, just a mat that my keyboard, mouse, and drink sit on. Sony only sent the Mat-D for me to test, and while it’s step up from my desk mat, I think it’d prefer the Mat-F for its higher friction.
Of all of Sony’s InZone gear, the product that I’ll miss the most is the H9 II headset. Despite its $349.99 price, you’re getting great audio quality for the money. And, thanks to its removable mic, using it as a set of headphones away from your desk won’t make you look as ridiculous as the first-gen model does. Each of the new products has redeeming qualities, but a lack of novelty and high prices across the board make them tough to broadly recommend.
Sony is a household name, but not so much in esports. It’s going up against companies that have been making similar products — often with lower prices — and have years of goodwill attached to their names. But I suppose every company has to start somewhere. High prices aside, this isn’t a bad place to begin.
Follow topics and authors from this story to see more like this in your personalized homepage feed and to receive email updates.
Craig Mazin will be The Last of Us season three’s lone writer after co-creator Neil Druckmann and co-writer Halley Gross announced they were returning to video game studio Naughty Dog to develop a new title. (Druckmann co-developed the original Last of Us game and directed The Last of Us: Part II, which he co-wrote with Gross.) Emmy-winning writer-director Mazin (Chernobyl), who this year is nominated for outstanding drama series, spoke to THR about how the HBO thriller focusing on the survivors of a mass fungal infection that collapses modern-day society has helped level up the art of game-to-small-screen adaptations and whether he’s already busy writing the third season.
Video game adaptations are nothing new, but a TV spinoff earning Emmys is. Has The Last of Us proved that video game adaptations can hold their own?
Yeah. I think that in the wake of The Last of Us, a ton of video game projects got greenlit. Fallout was already happening, and that was fantastic in its first season, and I’m really looking forward to the second season. There’s just this incredible wave coming. Like anything, when people first said, “Hey, let’s start adapting books into movies or television shows,” some of them are going to be great, some of them will stumble. But the idea that the industry has woken up to how rich some of that storytelling is and how wonderful it is to adapt is fantastic.
Where are you with writing season three?
This is kind of my favorite time. It’s very quiet. It’s just sitting here with my wonderful ergonomic keyboard and clacking away. The pages are happening, and I get to be a monk for a while, which I love, and I just write. It’s the purest form of what I do. And then in just a couple of months or so, that happy time will start to be less quiet because we begin a very long prep period while I’m still writing, and then we begin to shoot while I’m still writing. In seasons one and two, I finished writing about six weeks before we started shooting the last episode. I don’t necessarily recommend this method other than to say this works for me, but it is insane.
Now that Druckmann and Gross are stepping away to focus on Intergalactic: The Heretic Prophet, will the writing process change?
I don’t think it is, in the sense that I was pretty much a monk just writing in a room by myself for most of the time regardless. And I’ve gotten so much out of talking with them over the course of seasons one and two. When we made season two, we really were thinking about what comes after because you can’t really tell half of that story without thinking about what the whole story should be. So we really did get that work in. Neil’s always had a full-time job running Naughty Dog, so it’s always been me up in Canada [where the production is], and, ultimately, things are pretty much going to proceed as usual.
Pedro Pascal and Kaitlyn Dever in episode two of the second season.
Courtesy of HBO
What were the most challenging scenes to shoot, logistics- and VFX-wise?
Episode two, the attack on Jackson, Wyoming, was an enormous undertaking for everybody. It was hard to write, it was hard to plan, it was hard to shoot. The prosthetics, the stunts and then the visual effects afterward were just massive. So we had [VFX houses] Weta and DNEG and about five other companies all working together to create all of the moments, and that was insane.
There were nine episodes in the first season but only seven in this one, and yet the pacing feels so different. Despite the fact that everything takes place in a span of three days, the attack on Jackson feels like it was ages ago. How does it compare to the game?
The attack on Jackson is not in the video game, so that’s new to our show. It’s one of those surprises that people who played the game would be like, “Oh!” But, yeah, the characters have gone through quite a bit, but the way we use time, it’s almost like so much of season two is really about three days, and I love being able to focus in on a period of time.
The Last of Us subreddit is quite a busy place. How closely do you keep track of the chatter and are there responses that surprise you?
I don’t look at them, so I don’t know. Problem solved! I don’t go on Reddit. I mean, I’m always playing video games; I’m playing The Elder Scrolls IV: Oblivion Remastered right now. Sometimes I’ll go on Reddit when I’m like, “What is the best bow for an archer build?” That’s about as much Redditing as I do.
What lessons did you learn from Chernobyl that you brought with you to The Last of Us?
For starters, I learned how much attention to detail matters. [What] we showed in Chernobyl was really born out of a desire to be as respectful as possible to the culture. We were telling a story that impacted people who are still alive, who lost people.
I just had a sense that stories that have been told in the West about the Soviet Union were not accurate, and why not go for as real, real, real as you can? That approach to being as grounded as we can, especially in a genre story where there are monsters, is something that I brought forward. The style of shooting is something I pulled through — and I say it every time — but everything I ever learned about directing, I learned by watching Johan Renck direct Chernobyl. I really internalized the way that he used multiple cameras as an artistic choice, as opposed to just [shoot] faster.
The other thing that I learned from Chernobyl was how important it was for the people who were at the creative helm to pay as much attention to visual effects as they do to anything else that you don’t. In your mind, you think, “I’ll just send this away, it’ll come back, I’ll put it in the show.” It doesn’t work like that at all. It is almost like doing takes with an actor: “Great, now let’s try this. Great, let’s try this.” And then, “Ah, there it is.” And that process of working through visual effects is exhausting and exhaustive for everybody, but I think what we end up getting is pretty remarkable, and it makes the show better. I just believe that visual effects are beyond integral to the success of a show like ours.
Before Chernobyl, you worked on The Hangover films. How much are you itching to get back to comedy?
Not strong itches. I mean, I spent a long time doing comedy, and even though I’ve been doing drama — it’s been about five, six years. Prior to that, it was like 25 years of comedy. Look, I think I’ve told all the jokes. I think my comedy is used up. I like having moments. I like having moments inside of drama. And I love working with comedic actors in dramatic roles because we can find comedy in there. So you do a scene where you’ve got Catherine O’Hara and she has this very heavy scene with therapy and all the rest, but still we find the funny in it because, of course, we do. But going back to pure comedy, I think probably, no, I don’t think so.
Do you envision directing the first episode of TLOU season three as you’ve done with the first two seasons?
Yeah. Honestly, I’d love to direct more, but the problem is just logistics. I like to direct the first episode because you can prep the whole season. There are a lot of characters that get cast and there are a lot of decisions that get made about environments, so you can sort of prep a lot of the season by prepping and directing the first episode. As we’re going along, you have to prep the other episodes. We have directors alternating, and I’m on set doing — I don’t know what you’d call it — “showrunner QC” sounds insulting to our directors, who are amazing. But [I’m] just making sure everything is fitting together tonally. So it’s hard for me to then go prep something while I’m also still writing, but we’ll see if I can get away with [directing] more than one.
Are more people lining up for roles now that The Last of Us has more Emmy nods?
It’s not quite like people knocking on your door as much as I think after season one. There may have been actors who were unaware of the video game or the show, but what they were aware of was that we were filling up those guest actor Emmy categories pretty extensively. We had fewer actual guest actors in season two, but we’ve still got Jeffrey Wright, Joey Pantoliano, Kaitlyn Dever and Catherine O’Hara, [who] all got nominated [for best guest acting in a drama series]. So when we pull people in, I think at least in the community, there’s an understanding they’re going to get something juicy to do. They’re not glorified day players. We try and create these little tiny, impactful stories with really, really good actors. So as we head into season three, I hope that we’ll see a couple of more fascinating additions like that.
For me, it’s so much fun to [say], “Hey, let’s just get Melanie Lynskey, why don’t we?” And to discover brilliant new talent, Keivonn Montreal Woodard, who had never acted before, and there he is getting an Emmy nomination for season one — that was just incredible. And Storm Reid won — obviously, she wasn’t new, but it was giving actors these interesting things to do that maybe they don’t normally get to do. Nick Offerman, who also won, normally doesn’t get to play that guy. And I love doing that.
Who’s on your wish list for actors to write for?
My wishlist is Meryl Streep. I’ve always had [her] on my wishlist since I started in this business. I’ve never worked with her, but I met her when I was at the Golden Globes and I ran into somebody who was there with her. We were talking, and he was like, “Do you want to meet Meryl? She’s just around the corner. She’s going to walk over.” And I was like, “I would love to meet Meryl Streep. Yes!”
So she comes over and he [introduces us]. And I shook her hand and I went, “Pffff. You know!” [Raises hands] And she was like, “Yeah, I know.” I wanted to say, “Oh my God! I love you in this [and] this!” But I just figured, everyone always says that. I’m just going to package it into just, “Insert here, me just freaking out.” And she was really nice and seemed to accept that I was freaking out. So anyway, I short-handed it to, “You know!”
I have not spoken to Meryl Streep, I have not written anything for her — yet — but one day, one day!
You just announced you and podcast co-host John August are releasing a book based on ScriptNotes. Will Neil and Halley ever join the pod guests?
Neil and I have done at this point, 16 podcasts for the show and Halley’s been on, so that’s sort of that. ScriptNotes, the show has been going on forever. It was just hardcore screenwriting nerds, and it sort of expanded a bit. And we’ll get pitches from publicity people like, “Hey, would you like this person or this person?” But John and I have always felt we will bring guests on the show, but mostly we’re just keeping it a non-guest show so that it doesn’t turn into a talk show.
You got a tattoo of Ellie’s switchblade to commemorate The Last of Us’ success. Any plans to get any more show-inspired ink?
I don’t have a specific plan, but I’m thinking maybe when it’s over. The other possibility is that I go for a tattoo-per-show method, so I only have the one. I may say, “OK, this is my Last of Us tattoo, now let’s see what comes next, and maybe that’ll be the next one,” but no plans yet. “No ragrets!”
Since the second season only covered the first half of the second video game, what will the pacing and episode count be like for this next installment and beyond?
We’re kind of fiddling around with that — it’s a little bit of a trade secret at the moment. But I will say that season three will be longer than season two. Season three will be more on par with season one. More bang for the buck.
This story first appeared in an August stand-alone issue of The Hollywood Reporter magazine. To receive the magazine, click here to subscribe.
Now appearing in the role of nasty Bill Sikes in the musical Oliver! — Ron Sexsmith?
Well, not exactly. But Sexsmith had the character of Sikes in mind (specifically as played by Oliver Reed in the movie) when he wrote the original version of the song, “Damn Well Please,” a jaunty, pointed highlight of his new album, Hangover Terrace.
The song was initially intended as part of a musical Sexsmith was creating based on Deer Life, a fairytale book he wrote and illustrated, that was published in 2017.
“There’s this villain character that was going to sing that song,” Sexsmith, a great fan of classic musical theater, says on a video chat with BGS from his home in Stratford, Ontario, Canada. “I just remember thinking how Oliver Reed played Bill Sikes. But he didn’t sing, because the director said as soon as the villain starts singing it takes away from his threatening element. And I thought that was smart.”
So, while he is still looking to bring the musical to the stage, he had put this song in a drawer. Eventually, though, he reworked it as a screed against what he sees as oversensitivity endemic to our era, with everyone so easily offended, and set it to perky Baroque-pop music and a tone bearing more than a shadow of classic Ray Davies.
“I refashioned the lyrics to be more about a kind of grumpy, bickering kind of thing,” he says. “Just because sometimes I’ll get mad or because [he and his wife Colleen Hixenbaugh] will bicker sometimes about my wine consumption. And I’ll be like, ‘I can have wine.’ Or whatever. And I just felt that it was fun to sing. We tried it out in a concert recently and it went over really big.”
Now, just in case you’re confused, yes, this is that Ron Sexsmith – Mr. Sensitive himself, Mr. Melancholy, Mr. “Secret Heart” (the first song on his first real album, 1995’s Ron Sexsmith, and arguably his most enduring and much-covered number). All vulnerable and romantic.
Yes, it’s him, the guy known for wearing his heart on his sleeve, weaving his feelings into stunningly indelible melodies sung with engaging understatement, all endearing him to fans throughout North America and Europe, earning him 15 Juno Awards (including eight as Canadian Songwriter of the Year) and a 2010 documentary, Love Shines. The guy who has been lavishly praised by countless fellow artists, notably among them Elvis Costello, Nick Lowe, Steve Earle, Daniel Lanois, and Feist.
That Ron Sexsmith is here, slinging arrows at people he sees as too sensitive. “I’m intent on poking the bear,” he sings.
“It’s just kind of a song about the culture we’re in now, there were a lot of people tip-toeing around and afraid to offend all the time,” he says of “Damn Well Please.” “And I think maybe we’re coming out of that a bit now. When I played it live, there were some people who came up afterwards and told me they found it really empowering.”
He laughs.
“I don’t want to empower the wrong people, though.”
The fact is, he is feeling empowered to show that edgy side a bit more. While there is plenty of the sensitivity, the romance, the explorations of heart on this, his 17th studio album in three decades, there are several songs that show this trait, lashing out some at matters both cultural and personal.
In “Camelot Towers,” another with a clear nod to his Kinks devotion in its sharp view and Baroque-pop tones, he expresses disgust at the proliferation of fancifully named housing projects that in reality are blights. In “Outside Looking In,” with Hixenbaugh chiming in as something of a Greek chorus, he suggests that “some friends should come with expiry dates.”
Mr. Costello, one of his biggest heroes and biggest fans (as a songwriter he has ranked Sexsmith with Paul McCartney and Tim Hardin), famously arrived in the punk era bearing the tag of “angry young man” before later evolving with great emotional nuance. Has Sexsmith gone the other way, from genteel young balladeer to, at 61, an angry, uh… mature man?
“I guess it’s better late than never,” he says, a wry smile and shrug tilting his country-gentleman hat and large wire-rim glasses.
“I mean, my earlier albums were more melancholy and kind of sad, just based on what was happening. But I had a song on [2004’s] Retriever called ‘Wishing Wells’ that was kind of angry. And I’m sure I could go and find those songs throughout my career. They exist before this. Maybe they don’t all exist in one place like on this album.”
Make no mistake: He still wears his heart on his sleeve. In fact, the opening line of “Easy For You to Say” is “I wear my heart is on my sleeve.” And the very first words of the album’s first song, “Don’t Lose Sight,” are “Hearts get broken,” sung with great vulnerability.
In other places there’s the romance of wistful, poignant nostalgia, as in, “Cigarette and Cocktail,” a colorful portrait of the seemingly carefree life of earlier generations with “a cigarette in one hand and a cocktail in the other.”
“I wanted to express the full range of emotions, human emotions. I don’t want to be the master of one emotion, like some people do these days. ‘That’s the guy who writes all the sad songs,’ or ‘that’s the guy who writes all the ironic songs,’ you know. I want to be an actual human being.”
Hence Hangover Terrace spans from pastoral (“House of Love,” a lovely ballad with brass that’s an ode to “a dirty happy home” filled with play and laughter) to perky pop (“It’s Been a While,” his account of a reunion with his old bandmates, with “shades of our yesterdays” and ‘80s-ish Casio-like keyboard lines) to pumping power-chords (“Burgoyne Woods,” with a little spirit of the Who). Produced by Martin Terefe – who has worked with artists from James Blunt to Engelbert Humperdinck and produced three Sexsmith albums in the 2000s – at his bustling London studio complex, it features among its musicians former Pretenders/Paul McCartney guitarist Robbie McIntosh (he provided the Townshend-esque licks to “Burgoyne”) and keyboardist Ed Harcourt (a fine singer-songwriter in his own right). But for the variety, or because of it, there’s a flow, an arc – it’s not a big leap to imagine the album as being the tuneful bones of a musical or narrative song cycle.
“I think I could probably write a story where these songs would fit,” he says, noting that no one had mentioned that before. “In all my albums there is a document of a particular time or phase that I was going through. So definitely with this record it was coming off the heels of the pandemic and all that stuff. You could probably write a story. I don’t know if I’m the guy to do it. But yeah, I’m going to think about that.”
Much of this, he says, reflects the life he and Hixenbaugh have led since moving from Toronto to Stratford seven years ago. Especially the theater orientation.
“Stratford, where I live now, is an internationally renowned theater town,” he says. “People come here from all over to see the plays and musicals. Maggie Smith worked here, and Christopher Plummer. I really love the theater and feel we’ve landed in a kind of oasis. The world is going crazy and we’re going to plays and all. I can’t believe our luck that we ended up here.”
Even outside the theaters, in this Stratford, as that bard from the other Stratford put it, all the world’s a stage. The players there? Superb. And for this Canadian bard?
“It’s been inspiring,” he says. “We have a yard with all these critters running around, like rabbits and things. We had an owl. Didn’t have that in Toronto. I feel like Beatrix Potter or Huckleberry Finn. It’s a whole different way to live.”
That has also brought out a wistfulness that counters, or at least complements, some of the hotter feelings expressed. Take “Burgoyne Woods,” a look back to a time in his life when the world was open and the radio rocked.
“It’s a very nostalgic song for me,” he says. “Every song on this album has its own character and personality. Here, I like rock. I love The Who and all that stuff. I was trying to write that kind of thing they do. It’s about a time in my life with my high school friends and we’d just go on trips through the woods near our house.”
That was his hometown of St. Catherines, down near the Niagara Falls/Buffalo area.
“It was that free-range period where your parents don’t know what you’re doing,” he says. “You’re just out there and just, you know, doing things you shouldn’t do. And drinking.”
So sort of his “Cigarette and Cocktail.”
“Yes,” he says. “Exactly.”
Even in “Camelot Towers” Sexsmith has found himself considering the humanity within the walls of the eyesores. “I’m just noticing, I mean, obviously people live there and they make the most of it,” he says. “And my son [one of two adult children from a previous marriage] lives in a place like that. You walk the halls and you can hear the people or you smell the different foods that everyone’s cooking. I kind of get into that in the last verse. Everybody needs a home and a home is what you make it.”
So yeah. Mr. Sensitive hasn’t gone anywhere.
And how does he bring the curtain down on Hangover Terrace? Well, he’s sensitive there too. Several songs before the album’s close, in “Please Don’t Tell Me Why,” a buoyant folk-rocker reminiscent perhaps of the Beatles’ “I Will,” he lets us know what to expect, or not to expect. He’s all about cherishing the moment, relishing the life and love he’s built with Hixenbaugh, savoring the theater and the wildlife around their home, without looking down the road:
I don’t want to hear Don’t want to know The trouble that surrounds The happiness we’ve found Don’t want to see The way our story ends
That might even bring a tear to Bill Sikes’ cold eyes.
The first miRNA selected for this work, miR8, was highly upregulated in both the Ae. aegypti and An. gambiae fat body following blood feeding and targets the 3′ UTR region of secreted wingless-interacting molecule (Swim), a molecule involved with the Wnt/Wingless signaling pathway (Table 1) [40,41,42,43]. When miR8 was depleted in Ae. aegypti, Swim levels remained high following blood feeding and egg development was inhibited [41]. Another miRNA, miR34, showed differential expression in several different mosquito species during pathogen infection, including in An. gambiae where midgut expression was decreased following an infectious Plasmodium berghei (P. berghei) blood meal [22, 34, 44,45,46]. Specifically, miR34 was predicted to bind to Relish-like transcription factor 1 (Rel1) and Caspar transcripts, important factors in the Toll and IMD immune pathways, respectively [37, 46]. As Caspar is a negative regulator of the Relish-like transcription factor 2 (Rel2) and Cactus is a negative regulator of Rel1, Rel1 and Rel2 transcript levels were also assessed in target gene quantitative PCR (qPCR) reactions (Table 1). These transcripts, as well as mating induced stimulator of oogenesis (MISO), were predicted target genes of miR34 via the now defunct miRNA–mRNA binding prediction webtool Insectar (http://www.insectar.sanbi.ac.za/) [47]. Previously, knockdown of MISO transcripts using RNAi resulted in reduced egg production, indicating a potential role for miR34 in reproduction [48]. The third selected miRNA, miR305, was elevated in the ovaries and midgut of An. gambiae following blood feeding and was higher in midguts following an infectious Plasmodium-containing blood meal [36, 37]. Inhibition of miR305 decreased the midgut microbiota and increased resistance to P. falciparum, whereas enhancement of miR305 increased P. falciparum infection levels and led to higher levels of midgut microbiota [37]. This miRNA was predicted to target the 3′ UTR of APL1C and as APL1 is part of a complex that stabilizes the immune factor thioester-containing protein 1 (TEP1), which binds to the surface of Plasmodium leading to parasite destruction, miR305 may impact Plasmodium infection [37]. Supporting this, miR305 depletion in An. gambiae led to increased resistance to both P. falciparum and Plasmodium berghei infection and altered the levels of many immunity or anti-Plasmodium genes in mosquito midguts [43]. The final miRNA, miR375, was only detected in blood fed Ae. aegypti mosquitoes and was predicted to bind to the 5′ UTR of Toll pathway immune genes Cactus and Rel1 [49]. Expression of a miR375 mimic in Ae. aegypti mosquitoes or cells led to binding of the 5′ UTRs of Cactus and Rel1 and the upregulation of Cactus and downregulation of Rel1 [49]. Similar changes in target genes and an increase in Dengue virus type 2 titers were observed in Ae. albopictus Aag2 cell lines [49]. Although miR375 has not been studied in An. gambiae, this miRNA has an identical sequence to miR375 in Ae. aegypti and has also been predicted by Insectar to target An. gambiae Cactus and Rel1 along with other gene transcripts including Caspar and Rel2 [47].
Plasmid preparation and production
Sure 2 supercompetent E. coli cells (Agilent Technologies, 200152) were transformed as per kit instructions (SOC media was substituted for NZY + media) with pAcEGFP and pWTAgDNV plasmids [18]. Transformed colonies were plated on Luria broth agar plates with 100 µg/mL ampicillin and incubated at 37 °C overnight. Colony PCR was used to verify transformations and selected colonies were grown in 5 mL of Luria broth in a 37 °C shaker overnight and then preserved as glycerol stocks. Purified plasmids were produced by growing glycerol stocks in liquid culture as before, extracted using an Omega Bio-tek E.Z.N.A. Plasmid DNA Kit (D6942-02), and quantified using a NanoDrop ND-1000 spectrophotometer.
Intron design
A potential splice acceptor site in WT AgDNV was identified at position 463 of the gene encoding the viral protein using the neural-network-based NetGene2 predictive splicing server, which identifies transition sequences between introns and exons [50,51,52]. This sequence was converted from AG^ACGCAGACAG (with “^” indicating the predicted splicing site) into a splice donor site by replacing the intronic portion with the starting sequence of the second intron of An. gambiae RPS17 such that the new sequence was AG^GTAGGCGCGC. This sequence was further modified by two base pairs to AG^GTAAGTGCGC to match the An. gambiae U1 small nuclear RNA conserved region (Fig. 1A) [53]. This U1 sequence (GTAAGT) represents the binding site for the U1 small nuclear ribonucleoprotein which helps to form the spliceosome [53]. A splice acceptor with the sequence TACTGACATCCACTTTGCCTTTCTCTCCACAG was created to accompany this splice donor at position 464 of the gene encoding the viral protein by adding in the branch point, polypyrimidine tract, and intronic portion from the 3′ end of a chimeric human intron (last 32 nucleotides) preceding an immunoglobulin gene heavy chain variable region that is commonly found in commercial vectors such as in the pRL-CMV plasmid from Promega (Fig. 1A) [54,55,56]. This splice donor and splice acceptor site were initially chosen within AgDNV to attempt the creation of a nondefective recombinant AgDNV, as previously described for AaeDNV, but we later decided to use a co-transfection system with pWTAgDNV and a transducing plasmid with the artificial intron to create an EGFP reporter phenotype [20]. These developed splice donor and splice acceptor sites were placed within the EGFP gene of pAcEGFP at positions 334 and 337, respectively, to create a reporter phenotype such that improper intronic splicing or a lack of splicing would result in a stop codon within the EGFP gene and correct splicing would result in EGFP expression (Fig. 1B). Predicted splicing was examined at all steps using NetGene2 and the created splice donor and splice acceptor sequences both had a confidence scores of 1.0, indicating a high confidence in splicing [50].
miRNA and sponge selection
For intronic miRNA expression, endogenous pre-miRNA sequences were inserted into the created intron so that upon splicing, the pre-miRNA hairpin would be co-transcriptionally processed alongside EGFP transcripts [22,23,24]. Selected pre-miRNA sequences for An. gambiae miR8, miR34, miR305, and miR375, as well as a miRNA sponge against miR8 (miR8SP), were added to this developed intron to test the co-expression system and intronic splicing mechanism. A random nonsense RNA sequence (NS) was added to the intron as a control. These miRNAs and the miRNA sponge were chosen, as described above, on the basis of known or predicted effects on genes involved with immunity, pathogen defense, or reproduction in An. gambiae, Ae. aegypti, or relevant mosquito cell lines (Table 1). To test intron functionality and demonstrate that splicing is sequence-dependent, altered splice donor and splice acceptor site sequences were developed using site-directed mutagenesis of the pAcEGFPmiR8 plasmid [50]. When the splice donor site was changed by a single nucleotide (in bold) from AGGTAAGTGCGC to AGATAAGTGCGC, NetGene2 no longer identified this as a splice donor site. Similarly, when the splice acceptor site was changed by one nucleotide (in bold) from TACTGACATCCACTTTGCCTTTCTCTCCACAG to TACTGACATCCACTTTGCCTTTCTCTCCACAT, this site was no longer predicted to be a splice acceptor.
Cloning and intronic cargo
MluI and BstBI sites were introduced into the EGFP-encoding gene of pAcEGFP using site-directed mutagenesis to create synonymous mutations. A MluI site was created by altering position 327 of EGFP from C to G, and position 330 from C to T. A BstBI site was created in EGFP by switching position 348 from G to A. Endogenous An. gambiae pre-miRNA sequences from miRbase (https://www.mirbase.org/) were converted to DNA and used to order g-blocks from Integrated DNA Technologies (IDT) [22]. The mir8SP sequence contained ten repeated blocks of the reverse complement of mature An. gambiae miR8. Each block was separated by four spacer nucleotides and the entire sponge sequence was placed within the intron as with pre-miRNA sequences. A nonsense RNA (NS) was created using a random sequence with no matches to the An. gambiae genome or transcriptome when searched using the Basic Local Alignment Search Tool (BLAST). Each pre-miRNA, miRNA sponge, or nonsense RNA was coded on IDT g-blocks synthesized with flanking MluI and BstBI sites, EGFP segments to replace those removed during digestion, and the splice donor and splice acceptor sites (Table S1; Fig. 1A). G-blocks were subcloned into pJet using a CloneJet PCR Cloning Kit (ThermoFisher Scientific, K1231) and later digested using MluI and BstBI. These inserts were ligated into pAcEGFP that had also been digested with MluI and BstBI, and the resulting plasmid sequences were verified.
Cell culture and transfections
Sua5B and Moss55 An. gambiae cells were grown in 25 cc plug cap flasks at 28 °C and passaged once per week at a 1:5 dilution with Schneider’s Drosophila media with 10% fetal bovine serum (FBS) v/v. For transfections, cells were quantified using a hemocytometer and 6 × 106 cells were added to each well of a 6-well plate along with 3 mL of complete media and incubated overnight. Cells were transfected at ~70–80% confluence with a 1:2 ratio of pWTAgDNV to transducing plasmid with 830 ng pWTAgDNV and 1660 ng transducing plasmid per well using a Lipofectamine LTX with Plus Reagent kit (ThermoFisher Scientific, 15338030). Briefly, plasmids were added to a mix of 500 µL OptiMem media with 3 µL Plus reagent and incubated at room temperature for 10 min. Then, 5 µL Lipofectamine was added and tubes were incubated at room temperature for 25 min before transfecting each well with 500 µL of this mixture. Transducing plasmids were pAcEGFPmiR8, pAcEGFPmiR8SP, pAcEGFPmiR34, pAcEGFPmiR305, pAcEGFPmiR375, pAcEGFPNS, pAcEGFPSA, and pAcEGFPSD. Cells were incubated and imaged at 3 d post-transfection. RNA for splicing validation was also gathered 3 d post-transfection. Preliminary in vitro miRNA and target gene expression experiments harvested RNA at 5 d post transfection. For Sua5B in vitro miRNA and target gene expression, cells transfected with pWTAgDNV and pAcEGFPNS served as controls, whereas in Moss55 in vitro miRNA and target gene expression experiments, cells transfected with pWTAgDNV alone served as a control.
Viral production and quantification
To produce virus particles for mosquito infections, Moss55 cells were transfected with selected transducing and helper viruses (as described) and virions were extracted 3 d post-transfection by removing the media, washing cells with 1× phosphate-buffered saline (PBS), and suspending cells in 1 mL 1× PBS. Cells were lysed using three cycles of freeze-thawing and centrifuged at 5000 rpm for 5 min to pellet debris. The virus-containing supernatant was collected and plasmid DNA and free viral genomes were removed using an Ambion TURBO DNA-free kit (AM1907). DNA was extracted using an Omega Bio-tek E.Z.N.A Tissue DNA kit (D3396-02) and viral genome equivalents were determined using standard curves created using AgDNV-coding plasmids with a single copy of each gene-of-interest. Samples and standards were run using PerfeCTa SYBR Green FastMix (Quantabio, 95,072–012) on a Qiagen Rotor-Gene Q at 95 °C for 2 min followed by 40 cycles of 95 °C for 10 s, 60 °C for 40 s, and 72 °C for 30 s. Runs were finished with a melt step using a ramp of 55–99 °C rising by 1 °C each step. WT AgDNV was quantified using primers against AgDNV nonstructural gene 1 (NS-RT-IIIF: CATTCGATCACGGAGACCAC, NS-RT-IIIR: GCGCTTGTCGCACTAAGAAAC) and a standard curve of pWTAgDNV. Selected transducing viruses (vAcEGFPmiR8, vAcEGFPmiR8SP, vAcEGFPmiR34, vAcEGFPmiR305, vAcEGFPmiR375, vAcEGFPNS, vAcEGFPSA, and vAcEGFPSD) were quantified using primers against EGFP (GFP-RT-II-F497: TCAAGATCCGCCACAACATC, GFP-RT-II-R644: TTCTCGTTGGGGTCTTTGCT) and a standard curve of pAcEGFP. Each production of virus consisted of a mixture of vWTAcEGFP and a transducing virus.
Mosquito injections
Female An. gambiae mosquitoes (Keele strain) that were 3 d post-emergence were injected intrathoracically with 200 nL densovirus mixture containing both wild-type vWTAgDNV and transducing virus (either vAcEGFPmiR8, vAcEGFPmiR8SP, vAcEGFPmiR34, vAcEGFPmiR305, vAcEGFPmiR375, vAcEGFPNS, vAcEGFPSA, or vAcEGFPSD) using a Drummond Scientific Nanoject III (3-000-207) and Drummond Scientific 10 µL microcapillary tubes (3-000-210-G) pulled using a Sutter Instrument Co. Model P-2000 (Heat 400, Fil 4, Vel 40, Del 140 Pul 140). Three biological replicates in mosquitoes were completed. For each replicate, mosquitoes were injected with ~106–107 transducing virus particles and 106–108 WT DNV particles (Table S2). Mosquito treatment groups were kept in separate cardboard cup cages with 10% sugar solution w/vad libitum until RNA extraction or imaging. RNA was harvested and tested from three biological replicates.
RNA extractions and cDNA production
For both in vitro and in vivo experiments, RNA was extracted using an Omega Bio-tek MicroElute Total RNA Kit (R6831-02). For in vitro experiments, RNA was extracted 3 d post-transfection for intronic splicing assessments or 5 d post-transfection for miRNA and target gene quantification. For in vivo experiments, mosquitoes were individually homogenized 10 d post-injection in lysis buffer using zinc-plated steel BB pellets (Daisy 0.177 cal or 4.5 mm) and a Qiagen TissueLyser II with a lysis program lasting 2 min with a frequency of 30 Hz. Following homogenization, RNA was extracted and DNase treated either on the column using an Omega Bio-tek RNase-free DNase Set I kit (E1091) or following RNA extraction using an Ambion DNA-free DNA Removal Kit (AM1906). For target gene quantification or assessment of intronic splicing, cDNA was synthesized using a Quantabio qScript cDNA synthesis kit (95047–500); whereas for miRNA quantification, samples were converted to cDNA using the HighSpec option in the Qiagen miScript II RT kit (218161) and diluted 1:10.
Intronic splicing, miRNA expression, and target gene quantification
In vitro and in vivo intronic splicing was assessed using primers spanning the intronic region (GFP-COLPCRF: CTGACCTACGGCGTGCAGTGC, RGFP-COLPCRR: CGGCCATGATATAGACGTTGTGGC). PCR products were run on 2% agarose gels and imaged using a UVP GelDoc-It transilluminator. Spliced transcripts resulted in a product of 274 bp, whereas PCR reactions using DNA plasmid controls or unspliced transcripts produced variably sized amplicons depending on insert size with most being ~480 bp.
Target gene qPCR reactions were run on a Qiagen Rotor-Gene Q using PerfeCTa SYBR Green FastMix (Quantabio, 95072–012) or an Applied Biosystems 7900HTFast Real-Time PCR System with Applied Biosystems PowerUp SYBR Green Master Mix (A25724), with conditions of 95 °C for 2 min, 40 cycles of 95 °C for 10 s, 60 °C for 40 s, and 72 °C for 30 s, and a melt curve with a ramp from 55 °C to 99 °C with 1 °C change per step. Primers for An. gambiae Swim cDNA were developed during this study, whereas others came from published studies (Table S3) [48, 57,58,59,60].
Reactions to quantify miRNAs used Qiagen miScript SYBR Green PCR kits (218075) and a Qiagen Rotor-Gene Q with a universal reverse primer and forward primers consisting of the sequences of each mature miRNA (Table S4) [40]. An. gambiae U6 levels served as a reference with which to compare miRNA levels. Conditions for miRNA qPCR reactions were 95 °C for 15 min followed by 40 cycles of 95 °C for 15 s, 60 °C (for all miRNAs during cell culture replicates as well as for in vivomiR34) or 55 °C (all U6 reactions and in vivo miR375) for 60 s, and 72 °C for 20 s. All reactions ended with a melt curve consisting of a ramp from 55 °C to 99 °C that increased 1 °C per step.
Data analysis
All qPCR data was analyzed using the delta-delta Ct method to calculate the fold change in expression relative to reference genes (S7 for mRNA transcripts and U6 for mature miRNA quantification unless otherwise noted). The fold change expression data was log2 transformed and a D’Agostino–Pearson omnibus K2 test was used to assess normality in Graphpad Prism 9. If both the control and experimental groups passed the normality test, a parametric unpaired two-tailed t-test assuming equal standard deviations was used to measure statistical significance. If either or both groups failed the D’Agostino–Pearson normality test, a nonparametric two-tailed Mann–Whitney test was used to compare ranks and to assess significance. Significant P values (< 0.05) were reported on graphs. All graphs report fold change expression using a log2 scale. The mean and standard error of the mean was reported for groups analyzed using an unpaired t-test, whereas median and 95% confidence intervals were shown for groups compared using a nonparametric two-tailed Mann–Whitney test.
Energy if you have three Benched Evolution Pokémon!
