Author: admin

  • New neurochemical signature distinguishes Parkinson’s disease from essential tremor

    New neurochemical signature distinguishes Parkinson’s disease from essential tremor

    Researchers have identified a neurochemical signature that sets Parkinson’s disease apart from essential tremor – two of the most common movement disorders, but each linked to distinct changes in the brain.

    In a new study in Nature Communications, scientists from the Fralin Biomedical Research Institute at VTC and the Virginia Tech College of Science identified unique chemical signaling patterns of two key neurotransmitters – dopamine and serotonin – that distinguish these two disorders. 

    “This study builds on decades of work,” said Read Montague, a scientist at the Fralin Biomedical Research Institute and a co-senior author, who with colleagues developed the multi-faceted technologies and the theoretical constructs for the work over their 15 years at the research institute. 

     “From adapting behavioral game theory into something that functions like a medical test, to refining machine learning models that can see brain chemistry in real time – we’ve always aimed to translate insights into something clinically useful,” said Montague, who directs the Center for Human Neuroscience Research at the institute. “This study takes a clear step in that direction.”

    The researchers focused on a brain region involved in decision-making and reward processing – the caudate of the striatum. 

    Using a machine learning-enhanced electrochemical technique during deep brain stimulation (DBS) surgery on essential tremor and Parkinson’s patients, the team measured fast fluctuations as patients played a game involving fair and unfair offers – a task designed to understand decision-making and brain chemistry.

    In an early study to emerge from this work in 2018 in Neuropsychopharmacology, researchers revealed the first-ever recordings of simultaneous sub-second fluctuations of dopamine and serotonin during active decision-making in a conscious human subject. 

    The early breakthrough laid the groundwork for the latest.

    The data had been collected as long as eight years ago by Montague and his team at the research institute and their collaborators at Wake Forest University, but we came back at it with better tools and a fresh perspective – and finally saw what was there all along.”


    William “Matt” Howe, assistant professor, School of Neuroscience, Virginia Tech College of Science and co-senior author

    The rise and fall of neurochemicals

    During DBS surgeries in 2017 and 2018, Wake Forest University neurosurgeons Adrian Laxton and Stephen Tatter helped perform the recordings using carbon fiber electrodes in Parkinson’s disease and essential tremor patients while they played a game where they accept or reject offers. 

    The research protocol was carried during a part of the surgery where the neurosurgeons already monitor brain activity in real time to precisely locate a small target area of the brain for electrical stimulation to treat the symptoms of the disorders.

    Now, in the Nature Communications study, researchers applied a computational model to track how those patients formed and adjusted their expectations during the game, revealing signature chemical signaling patterns tied to each disorder.

     In people with essential tremor, monetary offers that violated their expectations during the game triggered a seesaw pattern – dopamine levels rose, while serotonin dropped. This oppositional response – with one neurotransmitter rising as the other fell – mirrored patterns seen in earlier studies of brain activity during decision-making.

    In the latest findings, this reciprocal neurochemical signaling was absent in patients with Parkinson’s disease.

    It’s known that dopamine-producing neurons die in Parkinson’s disease, so researchers expected dopamine to be the clearest chemical difference in the brain. 

    But when they looked closely – using refined tools and a model of how people formed expectations – it was not dopamine that best distinguished Parkinson’s from essential tremor. Instead, it was serotonin, a different neurotransmitter that has not been as prominent in theories of Parkinson’s disease, opening a new view and potentially powerful scientific and clinical insight into this disease.

    “What surprised us was how much serotonin stood out,” Howe said. “It wasn’t just that dopamine was disrupted. It was that the normal back-and-forth between dopamine and serotonin was gone. There’s neither the serotonin dip nor the dopamine rise. It’s not just one system being disrupted – it’s the lack of that dynamic interaction that turned out to be the clearest difference between Parkinson’s and essential tremor.”

    Learning by doing

    The computational model followed a form of machine learning known as reinforcement learning, which gradually improved its ability to detect patterns as it processed more data from past experiments. Earlier work from Montague and his colleague, Terry Lohrenz, established the importance of this process at the level of neurons and behavior, setting the groundwork for this new series of experiments and analyses.

    Co-first authors Alec Hartle, a School of Neuroscience doctoral student in Howe’s lab, and Paul Sands, a research assistant professor in Montague’s lab, reframed the task using an “ideal observer model” – a statistical tool that considers rewards and outcomes and simulates the best performance for a specified task. 

    Hartle did experiments in mice to inform the approach, which helped Sands refine and apply the statistical model to extract new insights from human patient decision-making behavior. 

    “What they added was a computational model of what the subjects expected would happen,” Howe said. “When we reframed the data that way, we were able to reveal a difference in how the brain responded in these two patient groups.”

    Researchers saw that certain prediction errors – mismatches between what the research subjects expected and what they received – evoked changes in serotonin activity that were strong indicators of which disease the patient had.

    Parkinson’s disease affects about 1 million people in the United States and more than 10 million globally, according to the Parkinson’s Foundation. Essential tremor is even more common, affecting an estimated 7 million Americans, based on research by Columbia University scientists.

    “It’s very powerful to link moment-to-moment changes in internal beliefs – here what a person expects from others – to measurable chemical signals in the brain,” said Dan Bang, an associate professor at the Center of Functionally Integrative Neuroscience at Aarhus University in Denmark, adjunct associate professor at the Fralin Biomedical Research Institute, and one of the study authors. “This opens a new window into how deeply human cognitive processes, like social evaluation, are shaped by disease.”

    A continuing source of insight

    The Nature Communications study draws on foundational theories of dopamine signaling – including work Montague helped shape nearly 30 years ago – and uses a parameter rooted in models his lab has been refining for decades to extract the dopamine and serotonin signals.

    The collaboration with Wake Forest was seeded by Kenneth Kishida, a co-first author on the original study who collected the original dataset while working with Montague as a postdoctoral associate at the Fralin Biomedical Research Institute before joining the faculty at Wake Forest University, where today he is the Boswell Presidential Chair of Neuroscience and Society.

    “It’s exciting to see that effort applied in a way that might help diagnose or stratify real clinical populations.” said Montague, who is also the director of the Center for Human Neuroscience Research and the Human Neuroimaging Laboratory of the Fralin Biomedical Research Institute and a professor in the Virginia Tech College of Science.

    The project also reflects years of iterative refinement and cross-disciplinary teamwork. 

    “These models improve over time as they’re trained on more data,” said Seth Batten, a co-author on the study. “The version we used in this study was far more refined than what we had early on. But just as important was the collaborative approach – bringing in new people with different expertise allowed us to see patterns we hadn’t recognized before.”

    While the findings offer new insight into how Parkinson’s disease and essential tremor differ at the chemical level, the researchers see this as just the beginning. 

    “That’s what I’m proudest of – the collaboration,” Howe said. “The data had long been collected, and it took people with different backgrounds coming together to make sense of it. This study tells a compelling story, but the story doesn’t end here.”

    The study was funded by the National Institutes of Health, the Lundbeck Foundation, the Fralin Biomedical Research Institute and the Red Gates Foundation.

    Additional co-authors on the study include:

    • Leonardo Barbosa and Jason White, Fralin Biomedical Research Institute at VTC;

    • Arian Sohrabi and Rebecca L. Calafiore, Wake Forest University School of Medicine;

    • Alexandra G. DiFeliceantonio, Fralin Biomedical Research Institute and Virginia Tech Department of Human Nutrition, Foods, and Exercise;

    • Mark R. Witcher, Carilion Clinic and Virginia Tech Carilion School of Medicine.

    Source:

    Journal reference:

    Hartle, A. E., et al. (2025) Caudate serotonin signaling during social exchange distinguishes essential tremor and Parkinson’s disease patients. Nature Communications. doi.org/10.1038/s41467-025-63079-w

    Continue Reading

  • Samsung’s Trifold Phone and AI Glasses Reportedly Set for Sept. 29 Launch

    Samsung’s Trifold Phone and AI Glasses Reportedly Set for Sept. 29 Launch

    Is three better than two? Apparently, we’re about to find out again.

    Samsung will reportedly launch its Galaxy Z TriFold in South Korea on Sept. 29 in its third Unpacked event of 2025. At the same time, the company will introduce its Project Moohan mixed-reality headset and AI smart glasses.

    If Samsung does indeed unleash the Galaxy Z TriFold later this month, it would be the second triple-screen phone. Huawei rolled out its Mate XT last year in China, and we liked it. The Mate XT is not available in the US, and it’s unknown when Samsung’s trifold will be available for US consumers.

    Samsung did not immediately respond to CNET’s request for comment.

    ‘Incredibly expensive and niche’

    Tech influencer Austin Evans, who has 5.68 million YouTube subscribers, says that after living with the Z Fold 7, he’s confident that Samsung will do well with its triple screen. 

    “It’s going to be incredibly expensive and niche, but to me it serves two roles for Samsung: a halo effect from its other products, and a way to continue their quest to own the foldable space in a way they had kind of lost the last few years to the Chinese market,” Evans told CNET.

    Evans isn’t convinced about the practicality or durability of trifolds just yet. 

    “I’m sure the production will be incredibly limited,” he told CNET. “A handful of enthusiasts will buy them to flex on their friends. Everyone else will look at it as a cool Samsung phone and go buy an S25.”

    ‘Trifold’ is a misleading term

    Although the term “trifold” is being widely used, these types of phones only fold on two hinges. We prefer the term “triple-screen phone” because of the three displays that are available when the phone is fully unfolded.

    Due to several rumors, we already have some idea of what the Z TriFold might look like. According to animations that @TechHighest showed on X last week, its main display will apparently fold in from the sides. When the phone is closed, there is a separate display on the other side of the phone.

    A report from South Korea also outlined more specs: a 10-inch OLED display, a triple-camera system with a 200-megapixel main camera, a 12-megapixel ultrawide camera, and a 10-megapixel telephoto camera. The price tag should be about $3,000.

    AI smart glasses 

    Samsung also appears ready to challenge Meta Ray-Ban smart glasses with its own intelligent specs. Samsung’s version will reportedly be audio only, powered by Qualcomm’s AR1 chip for AI smart glasses, and will presumably run Android XR.

    Evans isn’t so sure that Samsung will be able to compete with Meta.

    “Meta has such a dominating position with Ray-Ban right now, and the rumors seem pretty clear that we’ll be getting a big update at Meta Connect this month,” he said. “Samsung is right to try it, but I’m skeptical [it’s] the company that will crack this. It does feel like Meta’s market to lose.”


    Continue Reading

  • Sonny Baker endures nightmare debut as South Africa dominate first ODI | Cricket

    Sonny Baker endures nightmare debut as South Africa dominate first ODI | Cricket

    They say that if you fail to prepare you should prepare to fail, and it turns out that is what England were doing across the two understaffed days of training with which they launched themselves into this series.

    England proceeded to get bowled out for 131 in 24.3 overs before Aiden Markram humbled their bowlers – picking on the debutant Sonny Baker – and propelled South Africa towards victory by seven wickets, sealed with 175 balls to spare.

    A week before this match Temba Bavuma’s team, having just won a one-day international series in Australia, were in the middle of a convoluted, lengthy journey from Queensland to Yorkshire via Sydney, Singapore and London.

    It was England, though, who looked jet‑lagged by the less long-distance but more recent whiplash turnaround from the Hundred. Several squad members, with two selected for this series opener, were engaged in that competition’s final as recently as 48 hours earlier and in their absence the team’s first training session on Sunday was attended by just a handful of players, their second had less than two-thirds of the squad present, and the outcome was a powder‑puff display against match-honed and whip‑smart opponents.

    Harry Brook described talk of his team’s poor build-up as “an excuse” and insisted: “We’re not a team that makes excuses. We’re a team that tries to play our best cricket as much as possible. We’ve just got to crack on now and put that performance behind us.”

    Until they lost two wickets in two balls with the scores tied and the die cast the tourists’ performance had been as blemish‑free as England’s was error‑strewn. The home side’s collapse was hastened by some excellent fielding, with outstanding catches from Corbin Bosch to dismiss Jamie Smith – who later produced a superb grab of his own to end Markram’s rampage on 86 – and from Markram himself, diving to his left at slip, to account for Jofra Archer, as well as an excellent throw from Tristan Stubbs to facilitate Brook’s run-out.

    Aiden Markram drives on his way to a rapid 86 during South Africa’s victory against England. Photograph: Danny Lawson/PA

    The ICC’s rankings make Keshav Maharaj officially the best bowler in the world in this format and the spinner bewitched England across 33 deliveries that brought four wickets and the home side to their knees. On a pitch that offered no demons and an outfield that gave no encouragement to chasing fielders a superficially strong side folded feebly, losing their last seven wickets for just 29 runs. Maharaj said his side did not believe England’s half-baked preparations indicated they had been underestimated, but notably put their good performance down to “the guys putting in a lot of work, not just prior to this series but prior to Australia as well”.

    England’s efforts started badly, with Ben Duckett caught behind in the third over for just five, and improved only moderately from there before nosediving theatrically once Maharaj was introduced. Only four players reached double figures and Smith alone, with a score of 54, managed more than 15. But it was the opener who precipitated the collapse when, having reached his half-century from 46 balls, carefully laying the groundwork for a potentially match-defining contribution, he got out almost immediately.

    That took England’s score to 102 for four and their partnerships from there contributed five, 10, two, nothing, 12 and nothing.

    skip past newsletter promotion

    Baker’s selection added some interest to South Africa’s inevitable procession, though opening the bowling in defence of such a humble total might be the harshest of all possible debut assignments. It was pressure he struggled to handle and his first four overs duly went for 56, with Markram alone scoring 45 of them, though he improved in returning for three more after a change of ends.

    “He got a bit of tap at the start but the way he kept cracking on and digging deep was awesome to see and that’s exactly what we ask of every bowler,” Brook said. “He might have missed his execution the odd time but Markram played some unbelievably good shots as well, so hat’s off to him.”

    England might have shifted the momentum had the ball not bounced inches in front of Joe Root’s hands after Archer found Ryan Rickelton’s edge with the opener yet to score, or if they had reviewed an on-field not‑out decision when Archer trapped him lbw with his next ball. On a day of many failures, that one got lost in the deluge.

    Continue Reading

  • How early dementia signs could be detected in routine eye tests | Health

    How early dementia signs could be detected in routine eye tests | Health






    CDC


    By Stephen Beech

    Early signs of dementia could be detected in routine eye tests up to 20 years before symptoms appear, according to a new study.

    Opticians may be able to spot tell-tale signs of Alzheimer’s disease and other forms of the debilitating condition within the next few years just by looking into patients’ eyes, say scientists.

    American researchers have linked abnormal changes in the tiny blood vessels of the retinas of mice with a common genetic mutation known to increase the risk of Alzheimer’s – the most common form of dementia.

    The findings, published in the journal Alzheimer’s and Dementia, build on previous work from the same team at the Maine-based Jackson Laboratory (JAX), which found similar vascular changes in the brains of mice.

    The study linked abnormalities in specific retinal cells to early dementia risk, which the research team says strengthens the case that the retina is a “powerful biomarker” for Alzheimer’s and other dementias.

    Study co-leader Dr. Alaina Reagan, a JAX neuroscientist, said: “If you’re at an optometrist or ophthalmologist appointment, and they can see odd vascular changes in your retina, that could potentially represent something that is also happening in your brain, which could be very informative for early diagnostics.”

    She explained that, because the retina is part of the central nervous system, scientists often see it as an extension of the brain that shares essentially the same tissue.







    Early signs of dementia “could be detected in routine eye tests”

    Retinal scans in mice show normal blood vessels that are evenly spaced and well-organized (left). Scans of mice with the MTHFR677C>T mutation show blood vessels that more often cross over each other in unusual ways (center, marked in yellow) and more twisted or tortuous vessels (right, marked in yellow). (The Jackson Laboratory via SWNS)




    That’s why changes in retinal blood vessels can offer early clues about brain health and diseases such as Alzheimer’s.

    Dr. Reagan said, “Your retina is essentially your brain, but it’s much more accessible because your pupil is just a hole, and we can see tons of stuff.

    “All the cells are very similar, all the neurons are quite similar, all the immune cells are quite similar, and they behave similarly under pressure if you’ve got a disease.”

    The researchers studied mice with a mutation called MTHFR677C>T, which is found in up to 40% of people.

    They found that the mice’s retinas had twisted vessels, narrowed and swollen arteries, and less vessel branching as early as six months of age.

    The team said that this reflects similar changes in the brain linked to poor blood flow and increased risk of cognitive decline.

    Dr. Reagan said vessels that appear more twisted and looped than normal can signal problems with high blood pressure, as the narrowing tissue limits nutrient and oxygen transport.

    She added, “We can see these wavy vessels in the retinas, which can occur in people with dementia.

    “That speaks to a more systemic problem, not just a brain- or retina-specific problem. It could be a blood pressure problem affecting everything.”







    anil-baki-durmus-Rr9ZB_DIE8k-unsplash

    Anil Baki Durmus




    A study by the same group in 2022 revealed similar vascular changes in the brains of mice with the same MTHFR677C>T mutation, highlighting the link between vascular health in the retina that resembles human disease.

    Dr. Reagan said, “These mice have fewer vessels in their cortex and reduced blood flow to their brains.

    “These changes are subtle, but they are there.”

    The researchers also discovered changes in protein patterns in both the brain and retina.

    They found disruptions in how cells produce energy, remove damaged proteins, and maintain the structure and support of blood vessels, offering important clues about how the MTHFR677C>T mutation affects the eye.

    Dr. Reagan says the findings also support a growing theory that blood vessel health plays a “central” role in neurodegenerative diseases.

    She said: “A lot of these molecular changes are happening in conjunction, which suggests these systems in brain and retinal tissue are working in tandem.”

    Dr. Reagan says that, even though more studies are needed to gain a deeper understanding of how vascular health in the retina affects the risk of dementia, the new insights have “important” implications for people with this genetic factor.







    Early signs of dementia “could be detected in routine eye tests”

    A retinal scan of a young mouse with a common mutation called MTHFR677C>T, which is linked to Alzheimer’s disease risk, shows disease-like blood vessels that are twisted and irregular. (The Jackson Laboratory via SWNS)




    For example, the study also showed the influence of sex and age, with female mice showing worse outcomes.

    By 12 months, they showed reduced vessel density and branching, highlighting progressive vascular changes.

    Similarly, women develop dementia more often than men, according to the World Health Organization (WHO).

    To see if the link between the mutation and vascular changes occurs in humans, as well as whether the new insight could be used in eye exams, the researchers are teaming up with doctors and dementia care specialists at Northern Light Acadia Hospital in Bangor, Maine.

    The idea is to learn more about how eye health adds to the overall risk for dementia.

    Dr. Reagan added, “Most people over 50 have some kind of vision impairment and get checked annually for prescription changes.

    “Are they more at risk if they have these vascular changes, and is that a point when doctors could start mitigating brain changes?

    “That could be 20 years before cognitive damage becomes noticeable to patients and their families.”

    Continue Reading

  • Belgium to recognise Palestinian state at UN General Assembly

    Belgium to recognise Palestinian state at UN General Assembly

    Belgium will recognise a Palestinian state at the UN General Assembly, Foreign Minister Maxime Prevot said on Tuesday, adding to international pressure on Israel after similar moves by Australia, Britain, Canada and France.

    Under mounting global criticism for its war in Gaza, Israel has been angered by the pledges to formally recognise a Palestinian state at a summit during this month’s UN event. Belgium will join the signatories of the New York Declaration, paving the way for a two-state solution, or a Palestinian state co-existing in peace alongside Israel, Prevot said in a post on X.

    The decision comes “in light of the humanitarian tragedy unfolding in Palestine, particularly in Gaza, and in response to the violence perpetrated by Israel in violation of international law,” Prevot added.

    Belgium intends to recognize a Palestinian state as part of a joint diplomatic initiative led by France and Saudi Arabia, Prevot said. The move is described as a political signal also aimed at condemning Israel’s settlement expansion and military presence in the territories.

    US President Donald Trump has criticised Canada’s decision to back Palestinian statehood and Rubio has said the decision by France is reckless. The White House did not respond to a Reuters request for comment after Belgium’s statement.

    Read More: Red Cross warns against evacuation of Gaza City

    Belgium would also levy 12 “firm” sanctions on Israel, such as a ban on importing products from its settlements, a review of public procurement policies with Israeli companies and declaring Hamas leaders persona non grata in Belgium, Prevot said.

    European Union foreign ministers remained sharply divided during a meeting in Copenhagen on Saturday over the war in Gaza, with some urging the bloc to exert significant economic pressure on Israel, while others firmly opposed such measures.

    The Palestinians have long sought a state in the Israeli-occupied West Bank and Gaza, with East Jerusalem as its capital. The United States says such a state can only be set up through direct negotiations between Israelis and Palestinians.

    Belgium, a member of the European Union, took the decision to step up pressure on the Israeli government and Hamas, Prevot said. Prevot also emphasized Belgium’s commitment to Palestine’s reconstruction, adding that the country would advocate for “European measures targeting Hamas and supporting new Belgian initiatives to combat antisemitism.”

    The United States said on Friday it would bar Palestinian Authority President Mahmoud Abbas from travelling to New York in September for a United Nations summit, where several US allies are expected to formally recognise Palestine as a state.

    West Bank

    Reuters, citing three Israeli officials, reported in August that Israel is considering annexation in the occupied West Bank as a possible response to France and other countries recognising a Palestinian state.

    In 2024, the United Nations’ highest court ruled that Israel’s occupation of Palestinian territories, including the West Bank, and its settlements were illegal and should be withdrawn as soon as possible.

    Also Read: Over 1,000 dead in Sudan landslide as local group pleads for help

    Israel says the territories are not occupied in legal terms as they are on disputed land, but the United Nations and most of the international community see them as occupied territory. Israel’s annexations of East Jerusalem and the Golan Heights decades ago have not won international recognition.

    Israel launched its assault on the Gaza Strip in October 2023, after fighters from Hamas, the Palestinian militant group in control of the territory, attacked Israeli communities, killing 1,200 people and capturing more than 250 hostages.


    Continue Reading

  • UK borrowing costs hit 27-year high adding to pressure on Reeves

    UK borrowing costs hit 27-year high adding to pressure on Reeves

    Tom Espiner & Nick EdserBusiness reporters, BBC News

    Reuters Chancellor Rachel Reeves wearing a dark blue jacket emerges from the doorway of 11 Downing Street Reuters

    UK government long-term borrowing costs have reached their highest level since 1998, adding to the pressure on the chancellor ahead of the Budget.

    The interest rate on 30-year government bonds, known as the yield, jumped to 5.72%, making it more expensive for the government to borrow money.

    There are rising expectations that Chancellor Rachel Reeves will increase taxes in the Budget later this year in order to meet her borrowing and spending rules, as worries grow about the state of the government’s finances.

    On the currency markets, the pound also fell more than 1% against the dollar on Tuesday.

    Sterling fell against the dollar to $1.3388, which is the lowest level against the US currency since 7 August.

    The UK was not alone in seeing borrowing costs rise, with yields on 30-year German, French and Dutch bonds climbing to their highest since 2011.

    In the US, 30-year Treasury bond yields rose to their highest in more than a month.

    A number of factors have led to borrowing costs for governments around the globe to go up, such as geopolitical tensions, US President Donald Trump’s trade policies and the upcoming confidence vote in the French government.

    Ngozi Okonjo-Iweala, head of World Trade Organisation, said the world was currently “experiencing the largest disruption to global trade rules” which she said was “unprecedented in the past 80 years”.

    As she began her second term as director general, Ms Okonjo-Iweala also told Reuters that it might take until next year for the full effect of Trump’s tariffs to be felt as many businesses stocked up before they came into force.

    “Possibly down the line, we’ll begin to see some other impacts as the goods in the warehouses are exhausted and impacts begin to come in but we’ll see next year,” she said.

    “We still anticipate some growth.”

    ‘Difficult choices’

    But Susannah Streeter, head of money and markets at Hargreaves Lansdown, said the chancellor faced “highly difficult choices” in the Budget and that she had been “dealt a warning” by investors.

    “They are selling off UK government debt, clearly concerned that the government may be losing its grip on the public finances,” she said.

    In its manifesto, Labour promised not to raise taxes such as income tax, VAT or national insurance on “working people”. This has led to much speculation over what taxes Reeves could raise in the autumn Budget.

    One option suggested is that the freeze on income tax thresholds, which is due to end in 2028, could be extended.

    Often referred to as a “stealth tax”, freezing income tax thresholds means that, over time as salaries rise, more people are dragged into paying higher rates.

    There have also been reports that Reeves is considering reforming property taxes.

    “With so many options for raising taxes being bandied about during the summer, there appears to be concern that the decisions made might not be sufficiently thought through,” said Ms Streeter.

    “The worry isn’t just that government coffers won’t be replenished, but that they will be filled at the expense of growth, leading to a vicious circle emerging.”

    On Monday, the government announced a partial reshuffle, with Darren Jones, formerly Reeves’s deputy, being given a key No 10 role by the prime minister.

    The changes are focused on beefing up the economic know-how in Downing Street. Baroness Shafik, a former deputy governor of the Bank of England, has been named at Keir Starmer’s new chief economic adviser.

    The moves are a recognition that the upcoming autumn’s Budget will be a defining moment in this Labour government.

    Governments borrow money from investors by selling bonds – which is a loan the government promises to pay back at the end of an agreed time.

    The yield on 30-year UK government bonds – known as gilts – has been rising for some months, and this makes it more expensive for the government to borrow money due to higher interest payments.

    The government’s official forecaster, the Office for Budget Responsibility (OBR), takes borrowing costs into account when looking at whether the chancellor is meeting her self-imposed fiscal rules.

    When she became chancellor, Reeves set out two rules on government borrowing, which she has repeatedly said are “non-negotiable”. These were:

    • day-to-day government costs will be paid for by tax income, rather than borrowing by 2029-30
    • to get debt falling as a share of national income by the end of this parliament in 2029-30

    Part of the reason Reeves is under pressure is that her financial buffer to stick to these rules is a relatively slim £10bn. The chancellor recently refused to rule out tax rises after disappointing data on economic growth.

    On Tuesday, a spokesperson for Starmer said the government’s “iron-clad commitment to our robust fiscal rules remains”, adding it had made the necessary decisions to “stabilise the public finances”.

    But shadow chancellor Mel Stride said the latest market movements were “another economic disaster from Rachel Reeves – and a clear vote of no confidence in Labour from the markets”.

    “With more tax rises on the horizon, the economy is now in a precarious position,” he added.

    There has been a wide range of forecasts for how much money Reeves might need to raise in the Budget to meet her rules.

    One factor that will influence this is the borrowing costs facing the government.

    When the OBR makes makes its forecasts for government debt it looks at yields on all bonds.

    Paul Dales, chief UK economist at Capital Economics, said concerns about the path of UK inflation and interest rates, combined with global issues, were pushing UK government borrowing costs up.

    In addition, he added that pension funds were also not buying as much long-term government debt due to the change in recent years from defined-benefit to defined-contribution schemes.

    Mr Dales said Reeves would have to raise between £18bn and £28bn in the Budget to avoid breaking her fiscal rules, and to maintain her £10bn buffer.

    Households and banks “will probably feel the brunt of the higher taxes”, he said.

    Continue Reading

  • Cell membrane cholesterol affects serotonin transporter efflux due to altered transporter oligomerization

    Cell membrane cholesterol affects serotonin transporter efflux due to altered transporter oligomerization

    Material

    [3H]5-HT (43.1 µCI mmol−1), [3H]dopamine (51.4 µCI mmol−1), [3H]nisoxetine (46.0 µCI mmol−1), [3H]WIN35428 (CFT) (82.6 µCI mmol−1), and Ultima GoldTM XR liquid scintillation cocktail were purchased from PerkinElmer (Boston, MA, USA). [3H]MPP+ (60 µCi mmol−1) was obtained from American Radiolabeled Chemicals (St. Louis, MO, USA). Cell culture dishes were purchased from Sarstedt (Nuembrecht, Germany). Methyl-β-cyclodextrin (MβCD) and water-soluble cholesterol (cholesterol chelated with MβCD, 51 mg cholesterol/g MβCD) were from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals and cell culture supplies were from Sigma-Aldrich (St. Louis, MO, USA).

    Cell culture

    Human embryonic kidney (HEK) 293 cells (CRL-1573, ATCC, Manassas, Virginia, U.S.) stably expressing hSERT, hDAT, or hNET were maintained in humidified atmosphere (37 °C, 5% CO2) in Dulbecco’s Modified Eagle Medium (DMEM), supplemented with 10% heat-inactivated fetal calf serum (FCS), streptomycin (100 µg × 100 mL−1) and penicillin (100 U × 100 mL−1). Geneticin (50 µg × mL−1) was used as selection antibiotic. HEK293 cells have recently been authenticated using highly polymorphic short tandem repeat (STR) loci. STR loci were amplified with the PowerPlex® 16 HS System (Promega). Fragment analysis was done on an ABI3730xl (Life Technologies), and the resulting data were analyzed with GeneMarker HID software (Softgenetics). The results were matched with the Cellosaurus database to the cell line HEK293-DR-GFP-RAD51B-9 (RRID:CVCL_XX01): parental HEK293 cells (96.7%), stable HEK293 cell lines expressing YhDAT (90%)), YhNET (100%), and YhSERT (96.7%).

    Mutagenesis and transfection of SERT to reduce PIP2 binding capacity

    Mutations in SERT were introduced using the Quickchange Lightning Kit (Agilent) with the following primers: K352A: TGGCTTTTGCTAGCTACAACGCGTTCAACAACAACTGCTACC; K460A: GTTCCCACACGTCTGCGCAGCGCGCCGGGAGCGGTT. SERT-K352A/K460A was transiently transfected into HEK293 cells and grown in DMEM supplemented with 10% heat-inactivated FCS, streptomycin (100 µg × 100 mL−1), and penicillin (100 U × 100 mL−1) in a humidified atmosphere (37 °C, 5% CO2). Transfections were carried out using Lipofectamine Plus (Invitrogen); 5 µg of plasmid encoding SERT-K352A/K460A or wild-type SERT was used for transient transfection of cells in 10 cm culture dishes. Cells were assayed 48 h after transfection.

    Membrane cholesterol depletion and replenishment

    Freshly prepared solutions of MβCD or Cholesterol were dissolved in Krebs-HEPES buffer (KHB; 25 mM HEPES, 120 mM NaCl, 5 mM KCl, 1.2 mM CaCl2, 1.2 mM MgSO4, and 5 mM D-glucose, pH 7.3) and added to HEK293 cells expressing the MATs. The net amount of cholesterol in the cholesterol solution was calculated from the manufacturer’s lot data. A solution containing 50 µg/mL cholesterol had an approximate concentration of 1 mM MβCD as chelating agent. After incubation with various concentrations of MβCD or Cholesterol for 30 min at 37 °C, the buffer was aspirated, and the cells were washed twice with KHB. The cholesterol content in cell lysates was analyzed using the Amplex Red Cholesterol Assay Kit (Invitrogen) according to the manufacturer’s protocol.

    Cytotoxicity

    Potential cytotoxic effects of cholesterol depletion were assessed with the CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) (Promega GmbH, Walldorf, Germany) according to the manufacturer’s protocol. The cells were incubated with 6 and 10 mM MβCD for 30 min at 37 °C. Subsequently, MTT dye solution was added, and the plate was incubated for 2 h at 37 °C. After addition of the solubilization solution and incubation for 1 h, absorbance was recorded at 570 nm using a BioTek Synergy H1 hybrid multi-mode reader (Agilent Technologies Austria, Vienna, Austria) with integrated Gen5 microplate reader and imaging software. The relative cell viability was quantified by comparing the absorbance values of treated wells and compared to vehicle control wells.

    Uptake experiments

    Experiments were performed as previously described [51, 52]. One day before the experiment, cells expressing the respective transporter were seeded onto poly-D-lysine-coated 96 well plates at a density of 30,000 cells per well in a final volume of 200 µL. For uptake experiments, the cell culture medium was replaced with 300 µL KHB with or without MβCD or cholesterol for 30 min at 37 °C. Next, the buffer was aspirated, and the cells were washed twice with KHB to remove any MβCD or cholesterol from the buffer. Then, the buffer was replaced with 0.1 µM [3H]5-HT (SERT), 0.1 µM [3H]dopamine (DAT), or 0.05 µM [3H]MPP+ (NET), and various concentrations of unlabeled substrate in a total volume of 50 µL. Uptake was terminated after 60 s by washing the cells with 200 µL ice-cold KHB. Subsequently, the cells were lysed with 200 µL Ultima GoldTM XR liquid scintillation cocktail, and the amount of tritium in the cells was measured with a Wallac 1450 MicroBeta® TriLux liquid scintillation counter. Non-specific uptake was determined in the presence of 30 μM paroxetine (SERT), 30 μM cocaine (DAT), or 30 μM nisoxetine (NET). Monoamine uptake data were fitted by nonlinear regression, Vmax and Km values were calculated from Michaelis-Menten’s least-squares fit with GraphPad Prism (Prism 9.0.2, GraphPad Software, San Diego, CA, USA).

    Release experiments

    Release experiments were conducted as described earlier [53]. In brief, cells expressing the respective transporter were seeded onto poly-D-lysine coated 96 well plates at a density of 30,000 cells per well in a final volume of 200 µL, 24 h before the experiment. The next day, the cells were preloaded with [3H]5-HT (hSERT), [3H]dopamine (hDAT), or [3H]MPP+ (hNET) by incubation with 0.05 µM of the respective tritiated neurotransmitter in KHB for 20 min at 37 °C. Then, the cells were washed twice with KHB supplemented with or without MβCD or cholesterol and incubated for 30 min at 37 °C. Next, the buffer was aspirated, and the cells were washed twice with KHB to remove any MβCD or cholesterol from the buffer. Subsequently, the cells were incubated with various concentrations of d-methamphetamine (METH) or para-chloroamphetamine (pCA) for 10 min at room temperature. Next, the supernatant was transferred to another 96-well plate and 200 µL Ultima GoldTM XR liquid scintillation cocktail was added to the cells and supernatant. The amount of tritium in the cells and the supernatant was assessed with a Wallac 1450 MicroBeta® TriLux liquid scintillation counter. The release of tritiated neurotransmitters was expressed as a percentage of the total radioactivity of cells and supernatant together normalized to the basal efflux of untreated cells. Non-specific release was determined in the presence of 30 µM paroxetine, 10 µM mazindol, or 30 µM nisoxetine for SERT, DAT, or NET, respectively.

    Binding experiments

    Membrane binding experiments were conducted as previously shown [51, 54]. Membranes for binding experiments were prepared from HEK293 cells stably expressing the respective transporter. The cells were rinsed twice with phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4), harvested, and centrifuged at 400 g for 10 min at 4 °C. The pellets were resuspended in hypotonic HME buffer (20 mM HEPES NaOH pH 7.5, 1 mM EDTA, 2 mM MgCl2) and subsequently freeze-thawed twice using liquid nitrogen, followed by sonication for 10 s. Membranes were collected by centrifugation at 40,000 g for 15 min at 4 °C and resuspended in HME buffer. The membranes were pretreated with 6 mM MβCD, 0.1 mg/mL Chol, or vehicle for 30 min at 37 °C in binding buffer (20 mM Tris-HCl pH 7.5, 1 mM EDTA, 2 mM MgCl2, 120 mM NaCl, and 3 mM KCl). Next, the membranes were incubated with [3H]imipramine for SERT or [3H]CFT for DAT and NET in reactions of 0.3 mL. Nonspecific binding for SERT, DAT, and NET was determined in the presence of 10 µM paroxetine, 10 µM mazindol, and 30 µM nisoxetine, respectively. After 60 (SERT, DAT) or 30 min (NET), the reactions were terminated by rapid washing with ice-cold buffer and the membranes were collected onto glass fiber filters (Whatman GF/B). The samples were then dissolved in liquid scintillation cocktail and the amount of tritium bound to the membranes was determined by liquid scintillation counting.

    Whole-cell patch-clamp

    HEK293 cells stably expressing hSERT were seeded into poly-D-lysine coated 29 mm dishes (Nunclon™, Thermo Scientific, Denmark) at low density 24 h before the measurement. Substrate-induced SERT-mediated currents were determined as previously described [55, 56]. In brief, cells were voltage-clamped using the whole-cell patch-clamp technique. For recordings of steady-state currents and peak current recovery, glass pipettes were filled with internal solution (133 mM potassium gluconate, 5.9 mM NaCl, 1 mM CaCl2, 0.7 mM MgCl2, 10 mM HEPES, 10 mM EGTA, adjusted to pH 7.2 with KOH, final potassium concentration 163 mM). For recordings of peak currents relaxation rates, glass pipettes were filled with potassium and sodium-free internal solution (NaCl and potassium gluconate were replaced by NMDG chloride adjusted to pH 7.2 with NMDG). During measurements, the cells were continuously perfused with external solution (140 mM NaCl, 3 mM KCl, 2.5 mM CaCl2, 2 mM MgCl2, 10 mM HEPES, 20 mM glucose, adjusted to pH 7.3 with NaOH). Currents were recorded using an Axopatch 700B amplifier and pClamp 11.2 software (MDS Analytical Technologies) at room temperature. For recordings of steady-state currents, cells were voltage-clamped to a holding potential of −70 mV and 5-HT was applied for 5 s with intermittent washing steps of 5 s. For recordings of peak currents relaxation rates, cells were voltage-clamped to a holding potential of 0 mV and 5-HT was applied for 5 s with intermittent washing steps of 5 s. For peak current recovery recordings, cells were voltage-clamped to a holding potential of −70 mV and 10 µM 5-HT was applied for 500 ms followed by increasing washout intervals and subsequent 5-HT test pulses. The resulting current amplitudes in response to the 5-HT application were quantified using Clampfit 10.6 software. For analysis, traces were filtered using a 100-Hz digital Gaussian low-pass filter.

    Confocal microscopy

    HEK293 cells stably expressing YFP-hSERT, YFP-hDAT, or YFP-hNET were seeded into poly-D-lysine coated 29 mm dishes with 20 mm glass-bottom well (Cellvis, Sunnyvale, CA, USA) at a density of 20,000 cells per dish. The following day, the cell membranes were stained by incubation with 0.4% trypan blue for 1 min as previously described [34, 57,58,59]. Then, the dye was washed off and KHB supplemented with 10 mM MβCD or 0.1 mg/mL cholesterol was added. The dish was mounted above a 60× oil immersion objective on a Nikon A1R+ laser scanning confocal microscope system. Images were acquired using a 12 kHz resonant scanner. YFP was excited by a 488 nm laser line, while trypan blue was excited by a 561 nm laser line; the emission filters 525/50 nm and 595/50 nm were used. The emitted light was collected with a high-sensitivity GaAsP detector. The cells were imaged before and 30 min after the addition of MβCD, Chol, or blank.

    FRET imaging

    Experiments to assess the potential of membrane cholesterol alterations to induce conformational changes of the MATs were conducted using HEK293 cells transiently expressing a human SERT construct with either a fluorescence donor (CFP) or acceptor (YFP) attached to the N terminus. The cells were seeded into 29 mm dishes with 20 mm bottom (# 1.5 glass; Cellvis) at a density of 105 cells per dish two days before imaging. Before imaging, the cells were treated with MβCD, Chol, or vehicle for 30 min at 37 °C. FRET was measured with an iMIC inverted microscope (TILL Photonics GmbH) equipped with a 60× (1.49 NA) oil objective (Olympus). Fluorescence was excited with a 100 W Xenon Lamp (Polychrome, Till Photonics GmbH). The excitation light was filtered through 436/20 nm (CFP) or 514/10 nm (YFP) excitation filters (Semrock) and directed to the sample by a 442/514 dual-line dichroic mirror (Semrock). The emitted fluorescence light was filtered through a 480/40 nm and 570/80 nm dual emission filter (Semrock) and directed to a beamsplitter unit (Dichrotom, Till Photonics). The emission light was separated spatially according to the fluorescence wavelength using a 515 nm dichroic mirror (Semrock) and the resultant channels (<515 nm and >515 nm) were projected side by side onto an EMCCD chip (iXon Ultra 897Andor). Live Acquisition software (version 2.5.0.21; TILL Photonics GmbH) was used for recording. For optimal noise ratio and dynamic range, the camera was operated in 16-bit mode with a readout speed of 1 MHz. According to the manufacturer’s recommendation, an EM gain of 16 was applied to overcome the noise floor. Two images were taken per set (donor and acceptor emission after donor excitation and acceptor emission after acceptor excitation). Per cell treatment condition, ten sets were recorded on each experimental day and the images were then analyzed using Offline Analysis software (version 2.5.0.2; TILL Photonics GmbH). Background fluorescence was subtracted from each image and one region of interest (part of the plasma membrane) per cell was selected in the CFP channel. The average intensity of each region of interest was used for calculations. HEK293 cells expressing a CFP or YFP signal only were used to determine spectral bleed-through (BT) for the donor (0.57) and acceptor (0.04). Normalized FRET (NFRET) was calculated as follows:

    $${NFRET}=frac{{I}_{{FRET}}-{{BT}}_{{Donor}}times {I}_{{Donor}}-{{BT}}_{{Acceptor}}times {I}_{{Acceptor}}}{sqrt{{I}_{{Donor}}times {I}_{{Acceptor}}}}$$

    Maximum FRET was determined using a fused CFP-YFP construct [29].

    Single-molecule microscopy

    The mobile fraction and subunit stoichiometry of mGFP-hSERT were assessed as described previously [30, 41]. Fluorophores were excited at room temperature with 488 nm light from a directly modulated diode laser (LBX-488, installed in L6Cc laser combiner; Oxxius, Lannion, France). Custom-written software in LabVIEW (National Instruments, Austin, TX, USA) was used to adjust illumination intensity and timing. The laser beam was focused onto the back-focal plane of a Plan-Apochromat objective (100×/1.46 NA; Zeiss, Jena, Germany) mounted on an inverted Zeiss Axiovert 200 microscope. Appropriate emission filter sets (FF01-538/685-25; Semrock, Rochester, NY, USA, and zt488/640rpc; Chroma, Bellows Falls, VT, USA) were used to filter emission light. As detector we used a back-illuminated liquid nitrogen-cooled charge-coupled device camera (LNCCD1300-PB, Roper Scientific, Planegg, Germany). The excitation and photobleaching area was restricted by a slit aperture (Owis, Staufen im Breisgau, Germany). Stroboscopic illumination with excitation times of 5 ms was used; samples were excited and bleached in total internal reflection fluorescence (TIRF) mode.

    Fluorescence recovery after photobleaching (FRAP) experiments were performed to determine the mobile fraction of mGFP-hSERT. A small area of the plasma membrane (∼50 µm2) was photobleached in TIRF mode and the fluorescence signal was measured every 10 s within a total time interval of 400 s. The data were fitted by a one-phase association curve.

    $$I(t)/{I}_{0}={mf}times (1-{e}^{-{Kt}})$$

    I0 represents the fluorescence signal before photobleaching, I(t) the fluorescence signal at time t, mf the mobile fraction, and K the recovery rate constant.

    As individual single molecule signals cannot be distinguished as well-separated spots at high surface densities, a method referred to as “thinning out clusters while conserving stoichiometry of labeling” (TOCCSL) was applied to examine SERT oligomerization [30, 41, 60]. A prebleach image was recorded and used to assess the surface density of mGFP-hSERT. After 50 ms, an aperture-confined region of the bottom plasma membrane was photobleached for 2000 ms, using a laser intensity of ∼2 kW/cm2. The TOCCSL image was acquired after 15 s recovery time with a reduced excitation laser intensity of 0.4–0.6 kW/cm2 and used for obtaining the probability distribution of single spot brightness values B, ρ(B). To determine the brightness of single mGFP-hSERT molecules, ρ1(B), we repeatedly bleached cells for 200 ms with a laser intensity of ∼2 kW/cm2, resulting in only a few remaining fluorophores. Laser intensities were determined in epifluorescence configuration.

    TOCCSL images were analyzed using an in-house algorithm implemented in MATLAB (Mathworks, Portola Valley, CA, USA). Pixel counts were converted to photon counts by offset subtraction and multiplying with the inverse gain; individual diffraction-limited fluorescent signals were fitted by a Gaussian function. The probability distribution of single spot brightness values, ρ(B), was used to determine the oligomeric state of mGFP–hSERT. Applying autoconvolution, the monomer brightness distribution ρ1(B) was used to calculate the expected distributions for dimers ρ2(B) and higher-order oligomers. The overall single spot brightness distribution ρ(B) was then fitted by a linear combination of ρ1(B), ρ2(B), and higher-order oligomers.

    $$rho left({{{rm{B}}}}right)={sum }_{n=1}^{{n}_{max }}{alpha }_{n}times {rho }_{n}(B),{{{rm{with; normalization}}}}{sum }_{n=1}^{{n}_{max }}{alpha }_{n}=1$$

    Fitting ρ(B) yielded the fractions αn of the different oligomeric states of co-diffusing transporter molecules carrying an active mGFP molecule. To calculate the standard deviations of each analysis, a bootstrapping method was applied, in which 50% of the data were analyzed in 100 repetitions.

    Photoclick cholesterol labeling

    Photoclick cholesterol (Avanti, Alabaster, AL, USA) is a cholesterol analog with a photo-reactivatable diazirine group and an alkyne group for conjugation to azide by click chemistry [61]. Live cell photoclick cholesterol labeling was performed as described [61]. Briefly, HEK293 cells stably expressing YFP-tagged human SERT were treated with 20 µM photoclick cholesterol for 30 min at 37 °C in the presence and absence of 100 µM excess cholesterol as a competitor. The cells were washed twice with cold PBS and then irradiated under 365 nm UV light for 5 min. Cells treated with 20 µM photoclick cholesterol but not UV-irradiated were used as a negative control. Cells were then harvested and solubilized in lysis buffer containing 1% Triton X-100, 20 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM EDTA, 1 mM sodium orthovanadate, 5 mM NaF, 5 mM sodium pyrophosphate, and a protease inhibitor mixture. YFP-hSERT proteins were immunoprecipitated from cell lysates using GFP nanobody-conjugated agarose beads (GFP-TRAP; Chromotek, Planegg-Martinsried, Germany). Proteins were then released from the beads at 95 °C for 10 min in reduction and alkylation buffer (100 mM Tris-HCl; pH = 8.5, 1% sodium dodecyl sulfate, 10 mM tris(2-carboxyethyl) phosphine, 40 mM 2-chloroacetamide). The click chemistry reaction with released proteins was performed using the Click-&-Go Click Chemistry Reaction Buffer Kit (Click Chemistry Tools, Scottsdale, AZ, USA) with Cy5-azide and copper (II) sulfate according to the instructions with minor modifications. Following the click reaction, proteins were separated on SDS-PAGE gels, and Cy5 fluorescence was detected using a ChemiDoc MP imaging system (Bio-Rad, Hercules, CA, USA). Proteins were then transferred to a nitrocellulose membrane (Thermo Scientific) and immunostained with a rabbit anti-GFP polyclonal antibody (Thermo Scientific) followed by an HRP-conjugated goat anti-rabbit secondary antibody (Thermo Scientific). Chemiluminescence detection was conducted with the ChemiDoc MP system (Bio-Rad) and image analysis was carried out with Image Lab software (Bio-Rad).

    Statistical analysis

    Experimental data were analyzed using Microsoft Excel and Prism software (GraphPad 10.0.1, Software Inc., La Jolla, CA, USA). Vmax and Km values obtained from uptake experiments were analyzed with two-way ANOVA followed by Dunnett multiple comparisons test. Bmax and Kd values obtained from binding experiments were compared to control using the unpaired t-test. k0.5 values obtained from electrophysiological recordings were analyzed with two-way ANOVA followed by Dunnett multiple comparisons test. Transporter oligomerization effects were analyzed using two-way ANOVA followed by Sidak’s multiple comparison test. *, **, and *** indicate P < 0.05, <0.01, and <0.001, respectively. Changes in transporter efflux were analyzed using two-way ANOVA followed by Sidak’s multiple comparison test, *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively. The statistical tests used are given in each figure legend. Values are displayed as the mean and standard deviation. Values of p ≤ 0.05 were considered significantly different.

    Continue Reading

  • Comparison of EEG Burst Suppression and Hemodynamic Effects Between Re

    Comparison of EEG Burst Suppression and Hemodynamic Effects Between Re

    Ying Cao,1,&ast; Mi Gan,1,2,&ast; Linling Wan,3,&ast; Jun Lu,1,2 Ting Liu,1,2 Meiyan Liu,1,2 Di Wang,1 Sen Hong,1 Lin Zhou,1 Luying Deng,1 Zijun Wang,1 Jingjie Wang,1 Changyu Sun,1 Yang Liu,4 Yanqiu Liu,2,5 Meiwu Zhou1

    1Department of Anesthesiology, The Second People’s Hospital of Guiyang, The Affiliated Jinyang Hospital of Guizhou Medical University, Guiyang, People’s Republic of China; 2School of Anesthesiology, Guizhou Medical University, Guiyang, People’s Republic of China; 3Chongqing Population and Family Planning Science and Technology Research Institute, Chongqing, People’s Republic of China; 4Department of Anesthesiology, The Affiliated Hospital of Guizhou Medical University, Guiyang, People’s Republic of China; 5Department of Anesthesiology, The Fourth People’s Hospital of Guiyang, Guiyang, People’s Republic of China

    Correspondence: Yanqiu Liu, Department of Anesthesiology, The Fourth People’s Hospital of Guiyang, No. 91, Jiefang West Road, Nanming District, Guiyang, Guizhou, 550002, People’s Republic of China, Tel +86 13595161013, Email [email protected] Meiwu Zhou, Department of Anesthesiology, The Second People’s Hospital of Guiyang, The Affiliated Jinyang Hospital of Guizhou Medical University, No. 547, Jinyang South Road, Guanshanhu District, GuiYang, Guizhou, 550081, People’s Republic of China, Tel +86 15286065939, Email [email protected]

    Background: Remimazolam tosilate, a novel ultra-short-acting benzodiazepine, demonstrates promising safety profiles in clinical settings. While both remimazolam tosilate and etomidate provide hemodynamic stability during anesthesia induction, limited research has directly compared their effects on electroencephalogram (EEG) burst suppression (periods of transient brain wave silence), a potential predictor of adverse neurological outcomes. This study aims to compare the incidence rate of EEG burst suppression (ESR) with remimazolam tosilate versus etomidate by reviewing the drug regimens used by different anesthesiologists in clinical practice.
    Methods: This single-center retrospective study analyzed clinical anesthesia induction data from 161 patients from October 2023 to July 2024. Patients received either remimazolam tosilate (0.2 mg/kg, n=86, Group R) or etomidate (0.3 mg/kg, n=75, Group E) for general anesthesia induction. Primary outcomes included ESR and its duration during induction. Second outcomes comprised hemodynamic parameters: systolic blood pressure, diastolic blood pressure mean arterial pressure, and heart rate, measured at baseline (T0), 3 minutes post-induction (T1), immediately after intubation (T2), 5 minutes post-intubation (T3), 10 minutes post-intubation (T4), and adverse events occurrence.
    Results: Baseline characteristics were comparable except ASA classification (higher ASA III proportion in Group R: 24.4% vs 2.7%, P< 0.001). No ESR occurred in Group R versus 29.34% in Group E (P< 0.01). Group R had a significantly lower incidence of intubation-related hypertension (10.5% vs 42.7%, P< 0.001) and maintained stable blood pressure and HR throughout induction, whereas Group E exhibited marked MAP and HR fluctuations. Other adverse events showed no significant inter-group differences.
    Conclusion: Remimazolam tosilate demonstrated notable differences compared to etomidate during general anesthesia induction, including the absence of ESR and different hemodynamic response patterns. While these findings suggest potential advantages for certain patient populations, the retrospective design and ASA classification imbalance limit definitive conclusions, warranting prospective validation studies.

    Keywords: EEG burst suppression, remimazolam tosilate, etomidate, hemodynamic stability, general anesthesia induction

    Introduction

    Enhanced recovery after surgery (ERAS) programs represent evidence-based multimodal care pathways designed to optimize perioperative outcomes and minimize physiological stress responses.1,2 Within these protocols, the choice of anesthetic agents, particularly ultra-short-acting drugs, is pivotal for facilitating faster recovery and better perioperative management.3,4

    Electroencephalogram (EEG) burst suppression, first characterized by Derbyshire et al,5 manifests as a distinctive neural pattern alternating between high-voltage slow waves and periods of isoelectric suppression.6,7 This oscillating pattern demonstrates the brain’s transition between intense electrical activity and quiescent states.8,9 As a neurophysiological signature of severe cortical electrical inhibition, burst suppression can be triggered by various pathophysiological conditions, including hypothermia,10,11 hypoxia,12 hypoglycemia,13 and vascular brain injury.14,15 Furthermore, this pattern frequently emerges during deep anesthesia,16 serving as a reliable indicator of profound anesthetic states.17 Multiple studies have demonstrated robust associations between intraoperative burst suppression and adverse postoperative outcomes, particularly increased risk of perioperative neurocognitive disorders (PNDs), especially postoperative delirium (POD) and extended hospital stays.18–21 These associations likely involve disruption of normal cerebral homeostasis and potential neurotoxicity during periods of cortical suppression,22 which suggest that burst suppression patterns may serve as an important biomarker for identifying patients at increased risk for perioperative neurological complications.23

    Etomidate, despite its reputation for hemodynamic stability, has raised concerns regarding its propensity to induce EEG burst suppression during induction and its suppressive effects on adrenal function.24 In contrast, remimazolam tosilate is a novel ultra-short-acting benzodiazepine with distinct pharmacokinetic and pharmacodynamic features.25 It exhibits favorable pharmacological properties including rapid onset and offset, predictable clearance through tissue esterases, and improved controllability.26,27 However, comparative data regarding the incidence rate of EEG burst suppression (ESR) between these agents during anesthesia induction remain limited.

    Our team has long focused on brain function research during anesthesia, consistently implementing rigorous monitoring protocols including continuous EEG monitoring and automatic blood pressure recordings at 1-minute intervals during induction. Due to demonstrated hemodynamic advantages, more anesthesiologists have begun favoring remimazolam tosilate for induction in patients with higher ASA classifications. Through these meticulous practices in routine clinical care, we made an unexpected observation: EEG burst suppression patterns occurred predominantly when anesthesiologists employed their preferred etomidate-based protocols, while such patterns were notably absent with remimazolam tosilate regimens. This serendipitous finding prompted us to conduct a systematic retrospective analysis comparing ESR between these agents during anesthesia induction. Although remimazolam tosilate and etomidate differ in their pharmacological classifications—remimazolam being a benzodiazepine sedative and etomidate a potent hypnotic agent—our study focused on comparing their sedative effects during general anesthesia induction as routinely practiced in clinical settings. The choice of induction agent in each case was made by the attending anesthesiologist based on patient status and clinical preference. Sedation depth was quantitatively evaluated using the Patient State Index (PSI), providing an objective measure of anesthetic-induced cortical suppression. This approach allowed us to assess the real-world differences in sedative outcomes between the two drugs, despite their mechanistic distinctions.

    Material and Methods

    This single-center, retrospective study compared the ESR and its duration between remimazolam tosilate and etomidate during anesthesia induction, based on anesthetic regimens routinely selected by attending anesthesiologists. The study was approved by The Ethics Committee of the Second People’s Hospital of Guiyang (JYYY-2025-WZ-03), registered both in the National Medical Research Registration and Filing Information System (MR-52-25-014287) and Chinese Clinical Trial Registry (ChiCTR2500098018). The Ethics Committee waived the requirement for informed consent due to minimal patient risk and the impracticality of obtaining individual consent from patients lost to follow-up, with all procedures conducted in strict accordance with the Declaration of Helsinki and relevant ethical guidelines while ensuring patient anonymization and data security. We reviewed electronic records of 161 patients (aged 18–65 years, ASA I–III) who underwent elective surgery under general anesthesia between October 2023 and July 2024. Exclusion criteria included: 1. severe cardiovascular instability (eg, acute heart failure, severe arrhythmia, myocardial infarction); 2. uncontrolled hypertension; 3. anticipated difficult airway; 4. uncompleted or missing vital signs data; 5. records with documented protocol violations. To minimize potential selection bias, consecutive eligible cases during the study period were included. Data were extracted from the electronic medical record system by 4 independent investigators, with disagreements resolved through consultation with a senior anesthesiologist. The flowchart detailing the study design is illustrated in Figure 1.

    Figure 1 Study flowchart depicting patient enrollment, inclusion, and exclusion criteria.

    All patients observed standard fasting guidelines (6 hours for solids, 2 hours for clear fluids) preoperatively. Upon arrival in the operating room, routinely monitoring was initiated, including Electrocardiograph (ECG), peripheral oxygen saturation (SpO2), noninvasive blood pressure (NIBP) and continuous EEG monitoring using the Masimo SedLine® (PSA-4000, Masimo Corp., USA). This device recorded a four-channel EEG montage and generated the Patient State Index (PSI), a processed parameter reflecting sedation depth. During induction, PSI values were maintained between 20 and 50 to ensure an adequate level of unconsciousness. The use of this standardized EEG-based index enabled objective comparison of sedative effects between the two pharmacologically distinct agents. Following preoxygenation, general anesthesia was induced with either remimazolam tosilate (0.2 mg/kg, Group R) or etomidate (0.3 mg/kg, Group E) as the sole sedative hypnotic agent in their respective groups. The induction doses for both remimazolam tosilate and etomidate were calculated using adjusted body weight (ABW), determined by the formula: ABW = Ideal Body Weight (IBW) + 0.4 × (Actual Body Weight – IBW). The IBW was derived using the Devine formula: for males, IBW (kg) = 50 + 0.91 × (height in cm – 152.4); for females, IBW (kg) = 45.5 + 0.91 × (height in cm – 152.4). Subsequently, 0.5 µg/kg of sufentanil was administered, followed by 0.6 mg/kg of rocuronium after loss of eyelash reflex. Tracheal intubation was performed upon achieving complete muscle relaxation.

    Burst suppression was defined as an EEG pattern characterized by alternating epochs of high-voltage activity and periods of near-isoelectric suppression. Suppression was detected via the Suppression Ratio (SR), indicating the percentage of time the EEG signal is suppressed within a 63-second analysis window. All burst suppression events flagged by SR (> 0%) were confirmed by direct visual inspection of the raw four-channel EEG waveforms. The onset was defined as the first instance of SR > 0% accompanied by visible suppression, and the end was marked when SR returned to 0% with normal EEG continuity. Cumulative burst suppression duration was calculated by summing all suppression periods within the induction window.

    Outcome Assessment

    The primary outcomes were ESR occurrence and duration during anesthesia induction. ESR was quantified by both occurrence rate and duration metrics, with duration measured from initial onset to resolution (defined as the time interval between the first and last burst suppression pattern observed on EEG). Cumulative duration was calculated by summing all periods of burst suppression during the induction phase. Secondary outcomes included: (1) Hemodynamic parameters and fluctuations, and (2) Adverse events. Systolic blood pressure (SBP), diastolic blood pressure (DBP), mean arterial pressure (MAP), and heart rate (HR) were recorded at predefined time points: 1 minute before induction as baseline (T0), 3 minutes after induction (T1), immediately after tracheal intubation (T2), 5 minutes post-intubation (T3), and 10 minutes post-intubation (T4). Cardiovascular comorbidity (CV), defined primarily as arterial hypertension, was specifically analyzed to determine its potential impact on hemodynamic responses during anesthesia induction. Hemodynamic fluctuations were measured as ΔMAP (difference between maximum or minimum MAP and baseline MAP) and ΔHR (difference between maximum or minimum HR and baseline HR). Adverse events were defined as follows: hypotension (MAP decrease >20% from baseline or <60 mmHg), hypertension (MAP increase >20% from baseline or >120 mmHg), severe bradycardia (HR <45 bpm), and tachycardia (HR >100 bpm). Hypotension was treated with 6 mg ephedrine or 1 mg methoxamine boluses as needed, with continuous norepinephrine infusion initiated when necessary. Severe bradycardia was treated with 0.25–0.5 mg atropine until HR normalized. Temporal correlation between ESR patterns and hemodynamic variables was analyzed to evaluate potential associations between neurophysiological changes and cardiovascular stability during induction.

    Statistical Analysis

    Data analysis was performed using SPSS version 22.0 (IBM Corp, Armonk, NY, USA). The Shapiro–Wilk test assessed normality of distribution. Continuous variables with normal distribution (age, height, weight, BMI, ΔMAP, ΔHR and the duration of ESR) were presented as mean ± standard deviation and compared using independent-sample t-tests. Changes in hemodynamic parameters (ΔMAP, ΔHR) from baseline within each group were analyzed using paired t-tests. Categorical data (gender, surgical procedure, adverse events) were expressed as n (%) and analyzed using Chi-square or Fisher’s exact tests as appropriate. For ordinal data (ASA classification and the duration of ESR between groups), the Mann–Whitney U-test was employed. Post-hoc power analysis was performed using G*Power 3.1.9.7 software to evaluate the statistical power for detecting differences in burst suppression rates between groups, based on the observed effect size and actual sample sizes with α=0.05. Statistical significance was set at P<0.05. To minimize potential selection bias in this retrospective study, we performed: 1. Detailed analysis of baseline characteristics; 2. Multivariate logistic regression to adjust for potential confounders (age, ASA status, and baseline hemodynamics); 3. Pre-specified subgroup analyses based on ASA classification and the presence of cardiovascular comorbidities. Given the study’s focus on single-point outcome comparisons during induction, Repeated Measures ANOVA was not applied.

    Results

    Patient Characteristics

    Of the 161 patients reviewed, 86 received remimazolam tosilate (Group R) and 75 received etomidate (Group E). Baseline characteristics were generally well-balanced between groups. No significant differences were observed in age (45.5±12.9 vs 43.8±11.4 years, P=0.749), height (162±6.12 vs 162±8.46 cm, P=1.000), weight (63.9±8.89 vs 65.2±10.1 kg, P=0.778), BMI (24.20±2.99 vs 24.70±3.31 kg/m2, P=0.635). Gender distribution (male/female: 34/41 vs 36/50, P=0.651), or surgical procedure types (P=0.080). However, ASA classification differed significantly between groups, with Group R having a higher proportion of ASA III patients (24.4% vs 2.7%, P<0.001). To address potential selection bias in this retrospective study, multivariate logistic regression was performed to adjust for confounding factors (age, ASA status, and baseline hemodynamics), along with pre-specified subgroup analyses based on ASA classification and cardiovascular comorbidities (Table 1).

    Table 1 Demographic and Baseline Characteristics of Patients

    Subgroup analyses were conducted based on ASA classification, age, and CV comorbidity status. In the ASA subgroup analysis, BMI differed significantly among ASA III patients (26.4±3.3 kg/m² in Group R vs 24.1±3.5 kg/m² in Group E, P=0.045), whereas other baseline characteristics remained comparable. Age-stratified subgroup analysis showed broadly similar distributions of baseline characteristics between groups, except for the persistent imbalance in ASA classification (P<0.001) across both age categories. In the CV subgroups, significant differences were observed in age between groups (patients with CV comorbidities: 52.4±8.9 years in Group R vs 54.2±9.1 years in Group E; patients without CV comorbidities: 40.5±10.2 years in Group R vs 42.8±11.8 years in Group E; P=0.038) and ASA classification (P<0.001). Although multivariable regression was not employed, the consistency of ESR results across stratified subgroups mitigates the risk of baseline confounding. Notably, subgroup analysis specifically revealed significant differences between remimazolam and etomidate groups regarding age, BMI, and ASA classification among patients with CV comorbidities, predominantly arterial hypertension. This pattern indicates clinicians’ preferential selection of remimazolam tosilate for older patients with higher BMI and elevated ASA classifications, likely reflecting the drug’s favorable hemodynamic profile in this high-risk population. The persistent imbalance in ASA classification across subgroups, particularly among patients with arterial hypertension (higher prevalence of ASA III patients in Group R), necessitates cautious interpretation of the hemodynamic results and underscores the importance of appropriate statistical adjustments in our final analysis (Table 2).

    Table 2 Subgroup Analysis Results

    Primary Outcome

    ESR demonstrated significant intergroup differences, with a complete absence in Group R (0.00%) versus 29.34% occurrence in Group E (P<0.01). Post-hoc power analysis confirmed that the study achieved >99% statistical power to detect the observed difference in burst suppression rates between groups, supporting the reliability of our primary findings. Within Group E, ASA III patients showed higher ESR rates than ASA I–II (50.00% vs 28.77%), though limited ASA III sample size (n=2 vs n=73) precluded definitive statistical inference. When burst suppression occurred, onset was typically observed at 45 seconds post-etomidate administration (IQR: 32–67 seconds), with a median duration of 63.5 seconds (IQR: 42.5–89.0 seconds, range: 40–96 seconds) (Table 3). All ESR patterns resolved before the T3 measurement point. Representative EEG waveforms from both groups are shown in Figure 2.

    Table 3 ESR and Its Duration Between Two Groups

    Figure 2 The collected EEG and BS patterns from both groups. (A) EEG patterns from patients receiving etomidate, with typical burst suppression highlighted in red boxes; (B) EEG patterns from patients receiving remimazolam tosilate, demonstrating continuous EEG activity without evidence of burst suppression.

    Considering the observed baseline ASA imbalance, multivariate logistic regression analysis adjusting for age, ASA classification, and baseline hemodynamic parameters confirmed that the significantly lower ESR associated with remimazolam tosilate persisted (P<0.01). Subgroup analysis further revealed that within ASA III patients, burst suppression occurred only in the etomidate group (1 out of 2 patients), while none of the 21 ASA III patients in the remimazolam group exhibited burst suppression. Although subgroup numbers were limited, this finding qualitatively supports the robustness of the observed overall effect.

    Secondary Outcomes

    Hemodynamic Fluctuations

    Analysis of hemodynamic changes from baseline demonstrated significant differences between the two groups. In Group E, MAP showed a significant decrease at T1 (−5.5±9.9 mmHg, P=0.016), followed by a marked increase at T2 (15.0±10.4 mmHg, P<0.001) and then a significant decrease at T3 (−8.1±15.2 mmHg, P=0.003). Similarly, HR in Group E demonstrated significant decrease at T1 (−5.0±8.5 bpm, P<0.001), followed by an increase at T2 (6.3±11.3 bpm, P=0.002) and a marked decrease at T3 (−10.9±14.1 bpm, P<0.001). In contrast, Group R maintained relatively stable MAP with no significant changes from baseline at any timepoint (T1: 2.1±9.5 mmHg, P=0.405; T2: 1.1±10.9 mmHg, P=0.114; T3: 1.4±18.7 mmHg, P=0.111; T4: −3.4±15.9 mmHg, P=0.641). HR in Group R showed minimal but significant changes at T1 (−0.4±9.0 bpm, P=0.019) and T2 (−0.1±10.9 bpm, P=0.001). Comparison between groups revealed no significant differences in baseline MAP (95.0±14.1 vs 93.6±14.0 mmHg, P=0.144) or HR (77.8±11.3 vs 75.9±11.5 bpm, P=0.376). However, significant differences emerged at T1, T2, and T3 for both MAP (T1: P<0.001; T2: P<0.001; T3: P=0.002) and HR (T1: P<0.001; T2: P<0.001; T3: P=0.001). By T4, both groups showed similar recovery patterns with no significant between-group differences in either MAP (−3.2±16.5 vs −3.4±15.9 mmHg, P=0.141) or HR (−3.3±13.8 vs −3.5±14.2 bpm, P=0.311) (Table 4). Figure 3.

    Table 4 Hemodynamic Fluctuations Between Two Groups

    Figure 3 Vital signs at different time points between two groups. (A) ∆MAP at different time points between two groups; (B) ∆HR at different time points between two groups.

    Notes: Data are presented as mean ± SD. &P<0.05, P values were calculated using paired t-test comparing with baseline (T0); $P<0.05, P values were calculated using independent t-test between Group E and Group R.

    Adverse Events

    Analysis of adverse events demonstrated significant differences in hemodynamic stability between groups. Group R showed markedly lower incidence of hypertension compared to Group E (10.46% vs 42.67%, P<0.001), while other adverse events including hypotension (29.06% vs 41.33%, P=0.097), bradycardia (13.95% vs 22.67%, P=0.156), and tachycardia (15.11% vs 13.33%, P=0.745) showed no statistically significant differences. The pattern of adverse events demonstrates different hemodynamic response profiles between the agents, with remimazolam showing reduced hypertensive responses during induction, though both groups achieved similar hemodynamic recovery (Table 5).

    Table 5 Adverse Events Between Two Groups

    Subgroup analyses demonstrated that Group R maintained significantly lower hypertension rates across different patient populations, with notably reduced rates in ASA I–II patients (9.23% vs 42.47%, P<0.001) and consistent effects across both age groups (<60 years: 10.14% vs 41.38%, P<0.001; ≥60 years: 11.76% vs 47.06%, P=0.027). While the small sample size of ASA III patients in Group E (n=2) limited statistical comparison, Group R exhibited stable hemodynamics despite having more ASA III patients. Although older patients (≥60 years) showed slightly higher rates of hypotension in both groups, these differences were not statistically significant, suggesting remimazolam tosilate’s favorable hemodynamic profile persists across different risk stratifications (Table 6). The significant ASA classification imbalance across all subgroups represents a major study limitation that may confound interpretations, particularly given that anesthesiologist drug selection likely reflects patient risk assessment rather than randomized allocation.

    Table 6 Adverse Events Analysis by Subgroups

    Discussion

    This retrospective analysis demonstrated three key findings regarding remimazolam tosilate compared to etomidate during anesthesia induction: (1) no occurrence of EEG burst suppression with remimazolam tosilate versus 29.34% incidence with etomidate; (2) modest hemodynamic differences between groups, with both agents demonstrating reasonable cardiovascular stability; and (3) significantly lower incidence of hypertensive events in the remimazolam tosilate group (10.46% vs 42.67%). Although this study did not employ a formal multivariable regression model, we addressed confounding through structured subgroup analyses across ASA classification, age, and cardiovascular comorbidities. Despite a higher proportion of ASA III patients in the remimazolam group, ESR incidence remained consistently lower in all strata. These findings, supported by post-hoc power analysis and large effect size, strengthen the internal validity of our conclusions.

    EEG monitoring has become increasingly important in anesthetic practice, with guidelines emphasizing its role in optimizing anesthetic depth and preventing adverse outcomes.17,28,29 Recent studies have revealed that continuous monitoring of alpha oscillatory activity and other EEG parameters enables more precise individualization of anesthetic administration,30 which is especially valuable given the variability of anesthetic responses among patients. Our findings of zero ESR with remimazolam tosilate compared to 29.34% with etomidate demonstrate clinically relevant differences in neurophysiological effects during induction. Incorporating advanced EEG monitoring into routine practice has significantly enhanced our ability to deliver personalized anesthetic care, potentially lowering the risk of adverse neurological outcomes through more precise drug titration. Burst suppression has been associated with adverse perioperative neurological outcomes,31,32 particularly postoperative delirium which increases ICU stays and hospital costs.33,34 The observed differences likely reflect the distinct pharmacological mechanisms underlying these agents.

    The pharmacological basis for our findings can be attributed to different GABAa (γ-aminobutyric acid type A) receptor (GABAaR) binding sites and mechanisms between etomidate and remimazolam tosilate. Etomidate binds between alpha and beta subunits in the transmembrane domain, demonstrating enhanced potency at beta3 subunit-containing receptors and exhibiting distinct subunit selectivity that drives diverse clinical effects.35 Literature suggests that high-dose GABAa agonists such as etomidate can directly induce burst suppression through profound reduction of cerebral metabolic rate and direct cortical effects, independent of hemodynamic changes.36 Moreover, its selective action on alpha5 subunit-containing receptors forming “tonic” GABAaRs specifically mediates amnestic effects, highlighting the subtype-dependent nature of its pharmacological profile.37 Etomidate’s potent GABAaR-mediated cortical inhibition triggers profound neurophysiological changes, resulting in MAP fluctuations (ΔT1: −5.5±9.9 mmHg, P=0.016; ΔT2: 15.0±10.4 mmHg, P<0.001; ΔT3: −8.1±15.2 mmHg, P=0.003) coinciding with ESR onset at 45 seconds (IQR: 32–67 seconds), with a median duration of 63.5 seconds (IQR: 42.5–89.0 seconds, range: 40–96 seconds). This temporal relationship aligns with findings that deeper anesthesia may increase POD risk.38–40

    In contrast, remimazolam tosilate binds at the interface between alpha and gamma subunits and exhibits a ceiling effect on EEG depression characteristic of benzodiazepines, with burst suppression rarely observed when used alone.41 This inherent pharmacological characteristic makes remimazolam tosilate less likely to produce burst suppression compared to potent hypnotics like etomidate, independent of hemodynamic effects, thus explaining the absence of burst suppression and stable MAP throughout induction. These findings suggest that the differences in burst suppression rates are primarily attributable to pharmacodynamic properties rather than hemodynamic stability alone.

    A clinically significant finding was the four-fold difference in hypertensive events between groups (42.67% vs 10.46%, P<0.001). This disparity may be attributed to etomidate’s relatively short duration of action, potentially resulting in insufficient anesthetic depth by the time of laryngoscopy and inadequate suppression of sympathetic stress response to airway manipulation. Conversely, remimazolam tosilate appears to provide more sustained anesthetic effect during induction, maintaining adequate depth throughout intubation and attenuating sympathetic response.42,43 Importantly, although we initially speculated that remimazolam tosilate’s more stable hemodynamic profile might explain its lower BS incidence, further analysis suggests this is unlikely to be the sole factor. Both groups demonstrated similar rates of hypotensive events (29.06% vs 41.33%, P=0.097), with MAP increasing following intubation in both groups, though notably greater with etomidate (approximately +15 mmHg vs +1 mmHg at T2). Thus, we emphasize that pharmacodynamic differences in EEG suppression potential are a more plausible mechanistic explanation. Despite statistical significance, the magnitude of these differences (approximately 5–15 mmHg for MAP) was modest and likely clinically insignificant for healthy adults.44 Nevertheless, this observation carries practical clinical implications, particularly given etomidate’s reputation for hemodynamic stability. Our findings suggest that while etomidate may preserve baseline cardiovascular parameters, remimazolam tosilate demonstrated different patterns in controlling intubation-related hypertensive responses, which may be relevant for perioperative cardiovascular management in susceptible patients. Although our results demonstrated a complete absence of EEG burst suppression in the remimazolam group, it is important to note that our study only captured a brief observation window during anesthesia induction. The burst suppression episodes observed in the etomidate group were short in duration—typically lasting seconds to a few minutes—rather than prolonged. Existing literature suggests that sustained or repeated burst suppression, particularly during cardiopulmonary bypass or deep anesthesia maintenance, is more clearly associated with adverse postoperative neurocognitive outcomes. By contrast, transient burst suppression occurring at induction may carry less clinical significance. Nevertheless, even brief burst suppression episodes could be undesirable in high-risk populations such as the elderly or patients with cerebrovascular disease. Therefore, the clinical advantage of remimazolam tosilate may be better understood not as a result of superior hemodynamic stability—which was modestly different between groups—but as a consequence of its pharmacodynamic ceiling effect on EEG suppression. Avoiding even momentary burst suppression during induction could help reduce neurological risk in susceptible individuals. Notably, Group R showed consistently lower ESR across ASA classifications (ASA I–II: 0% vs 28.77%, P<0.01), aligning with evidence that patients with fewer comorbidities are more susceptible to anesthetic depth-related cognitive effects,45 particularly given POD’s association with increased one-year mortality (12% vs 6%).46 Consequently, while etomidate can serve as a general anesthetic, benzodiazepines like remimazolam tosilate are primarily employed as sedatives and anxiolytics.47–49

    As a retrospective analysis, this study has inherent limitations. First, potential underreporting or incomplete documentation of ESR events during anesthesia induction may affect the accuracy of the findings. Patients often exhibit involuntary movements during general anesthesia induction, complicating the acquisition of clear, noise-free EEG signals, which contributed to the relatively limited number of cases included in this study. Second, although our study population had a relatively normal BMI distribution (mean approximately 24 kg/m², with no patients exceeding 35 kg/m²), thus minimizing dosing discrepancies, we acknowledge an important methodological consideration regarding dosage calculations for anesthetic induction agents. In our study, remimazolam tosilate and etomidate doses were calculated using ABW, accounting for the difference between actual and ideal body weights. However, it is essential to emphasize the recommended practice of dosing based on ideal or lean body weight for markedly obese patients, as overdosing based on actual weight in these populations could increase the risk of excessive sedation, hemodynamic instability, and EEG burst suppression. Previous pharmacokinetic studies indicate that anesthetic doses based on ideal or adjusted body weight effectively reduce drug accumulation and adverse events in obese patients.50 Third, the lack of postoperative follow-up precluded evaluation of long-term neurological outcomes. Lastly, despite careful statistical adjustment for potential confounders including ASA classification, age, and baseline hemodynamics, the significant imbalance in ASA classification—specifically the higher prevalence of ASA III patients in the group R-remains an important methodological consideration. This baseline imbalance likely reflects anesthesiologists’ clinical preference for remimazolam tosilate in older, hypertensive, and higher-risk patients due to its favorable hemodynamic profile. Although our adjusted analyses and subgroup assessments confirmed the robustness of the primary findings, the limited sample size within certain subgroups, particularly ASA III patients receiving etomidate, necessitates cautious interpretation of the results. We speculate that the lower ESR associated with remimazolam tosilate may be related to its more stable hemodynamic profile during anesthesia induction, potentially minimizing cerebral perfusion fluctuations and reducing the risk of adverse neurological outcomes. However, future prospective randomized controlled trials with balanced ASA classifications, rigorous monitoring protocols, standardized dosage strategies across diverse populations, and long-term neurological follow-up are essential to validate these preliminary observations and definitively establish the clinical advantages of remimazolam in specific high-risk populations.

    Conclusion

    Our findings suggest that remimazolam tosilate offers advantages over etomidate in terms of a reduced incidence of EEG burst suppression and more stable hemodynamics during induction, in a retrospective analysis. However, given the study’s limitations, further prospective research is warranted to confirm these observations.

    Abbreviations

    EEG, electroencephalogram; BS, burst suppression; ESR, the incidence rate of EEG burst suppression; SBP, systolic blood pressure; DBP, diastolic blood pressure; MAP, mean arterial pressure; HR, heart rate; ERAS, Enhanced recovery after surgery; PNDs, perioperative neurocognitive disorders; POD, postoperative delirium; ECG, Electrocardiograph; SpO2, peripheral oxygen saturation; NIBP, noninvasive blood pressure; PSI, Patient State Index; Group E, 0.3 mg/kg etomidate group; Group R, 0.2 mg/kg remimazolam tosilate group; BMI, body mass index; ASA, American Society of Anaesthesiologists; n, number; Gender (M/F), Gender Male/Female; bpm, beat per minute; CV, cardiovascular comorbidities; GABAa, γ-aminobutyric acid type A.

    Data Sharing Statement

    The datasets generated during and/or analyzed during the current study are not publicly available due to the privacy policy but are available from the corresponding authors on reasonable requests.

    Author Contributions

    All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

    Funding

    This work was supported by the Fund of Guiyang Municipal Health Commission Science and Technology Program, High-Level Innovative Young Health Professionals Training Project, (YC, [2020] ZhuWeijianKejiHetong, Contract No. 006), the Fund of Chongqing Municipal Health Commission Medical Research Project, (LLW, 2023WSJK030), the Science and Technology Fund Project of Guizhou Health Commission in 2025 (YC, gzwkj2025-083), the Regional Science Fund Project from the National Natural Science Foundation of China (YL, Grant No. 82460244), the Seed Foundation of Guiyang Second People’s Hospital Doctoral Research Project (YC, Contact No. ZhuErYiKeYan-BS[2024]06).

    Disclosure

    The authors report no conflicts of interest in this work.

    References

    1. Wang SK, Wang QJ, Wang P, et al. The impact of frailty on clinical outcomes of older patients undergoing enhanced recovery after lumbar fusion surgery: a prospective cohort study. Int J Surg. 2024;110(8):4785–4795. doi:10.1097/JS9.0000000000001594

    2. Kehlet H. Multimodal approach to control postoperative pathophysiology and rehabilitation. Br J Anaesth. 1997;78(5):606–617. doi:10.1093/bja/78.5.606

    3. Kim KM. Remimazolam: pharmacological characteristics and clinical applications in anesthesiology. Anesth Pain Med (Seoul). 2022;17(1):1–11. doi:10.17085/apm.21115

    4. Zargar-Shoshtari K, Hill AG. Optimization of perioperative care for colonic surgery: a review of the evidence. ANZ J Surg. 2008;78(1–2):13–23. doi:10.1111/j.1445-2197.2007.04350.x

    5. Belsey R. Resection and reconstruction of the intrathoracic trachea. Br J Surg. 1950;38(150):200–205. doi:10.1002/bjs.18003815008

    6. Pawar N, Barreto Chang OL. Burst Suppression During General Anesthesia and Postoperative Outcomes: mini Review. Front Syst Neurosci. 2021;15:767489. doi:10.3389/fnsys.2021.767489

    7. Amzica F. What does burst suppression really mean? Epilepsy Behav. 2015;49:234–237. doi:10.1016/j.yebeh.2015.06.012

    8. Fleischmann A, Pilge S, Kiel T, Kratzer S, Schneider G, Kreuzer M. Substance-Specific Differences in Human Electroencephalographic Burst Suppression Patterns. Front Hum Neurosci. 2018;12:368. doi:10.3389/fnhum.2018.00368

    9. Cartailler J, Parutto P, Touchard C, Vallée F, Holcman D. Alpha rhythm collapse predicts iso-electric suppressions during anesthesia. Commun Biol. 2019;2:327. doi:10.1038/s42003-019-0575-3

    10. Saczynski JS, Marcantonio ER, Quach L, et al. Cognitive trajectories after postoperative delirium. N Engl J Med. 2012;367(1):30–39. doi:10.1056/NEJMoa1112923

    11. Seder DB, Fraser GL, Robbins T, Libby L, Riker RR. The bispectral index and suppression ratio are very early predictors of neurological outcome during therapeutic hypothermia after cardiac arrest. Intensive Care Medicine. 2010;36(2):281–288. doi:10.1007/s00134-009-1691-1

    12. Liu N, Chazot T, Mutter C, Fischler M. Elevated burst suppression ratio: the possible role of hypoxemia. Anesth Analg. 2006;103(6):1609–1610. doi:10.1213/01.ane.0000246268.58067.99

    13. Declerck A, Liu N, Chazot T, Fischler M. BIS values during resuscitation: the role of the suppression ratio (case report). J Clin Monit Comput. 2009;23(5):307–309. doi:10.1007/s10877-009-9197-5

    14. Johansen JW. Esmolol promotes electroencephalographic burst suppression during propofol/alfentanil anesthesia. Anesth Analg. 2001;93(6):1526–1531. doi:10.1097/00000539-200112000-00039

    15. Umegaki N, Hirota K, Kitayama M, Yatsu Y, Ishihara H, Mtasuki A. A marked decrease in bispectral index with elevation of suppression ratio by cervical haematoma reducing cerebral perfusion pressure. J Clin Neurosci. 2003;10(6):694–696. doi:10.1016/j.jocn.2002.11.001

    16. Hayashida M, Sekiyama H, Orii R, et al. Effects of deep hypothermic circulatory arrest with retrograde cerebral perfusion on electroencephalographic bispectral index and suppression ratio. J Cardiothorac Vasc Anesth. 2007;21(1):61–67. doi:10.1053/j.jvca.2006.02.029

    17. Shanker A, Abel JH, Schamberg G, Brown EN. Etiology of Burst Suppression EEG Patterns. Front Psychol. 2021;12:673529. doi:10.3389/fpsyg.2021.673529

    18. Fang PP, Shang ZX, Xu J, et al. Contribution of intraoperative electroencephalogram suppression to frailty-associated postoperative delirium: mediation analysis of a prospective surgical cohort. Br J Anaesth. 2023;130(2):e263–e271. doi:10.1016/j.bja.2022.11.002

    19. Fritz BA, Kalarickal PL, Maybrier HR, et al. Intraoperative Electroencephalogram Suppression Predicts Postoperative Delirium. Anesth Analg. 2016;122(1):234–242. doi:10.1213/ane.0000000000000989

    20. Tymianski M, Tator CH. Normal and abnormal calcium homeostasis in neurons: a basis for the pathophysiology of traumatic and ischemic central nervous system injury. Neurosurgery. 1996;38(6):1176–1195. doi:10.1097/00006123-199606000-00028

    21. Hesse S, Kreuzer M, Hight D, et al. Association of electroencephalogram trajectories during emergence from anaesthesia with delirium in the postanaesthesia care unit: an early sign of postoperative complications. Br J Anaesth. 2019;122(5):622–634. doi:10.1016/j.bja.2018.09.016

    22. Lewis LD, Ching S, Weiner VS, et al. Local cortical dynamics of burst suppression in the anaesthetized brain. Brain. 2013;136(Pt 9):2727–2737. doi:10.1093/brain/awt174

    23. Yang T, Velagapudi R, Terrando N. Neuroinflammation after surgery: from mechanisms to therapeutic targets. Nat Immunol. 2020;21(11):1319–1326. doi:10.1038/s41590-020-00812-1

    24. Butovas S, Rudolph U, Jurd R, Schwarz C, Antkowiak B. Activity patterns in the prefrontal cortex and hippocampus during and after awakening from etomidate anesthesia. Anesthesiology. 2010;113(1):48–57. doi:10.1097/ALN.0b013e3181dc1db7

    25. J DU, Licheri M, Barucco G, et al. Remimazolam for anesthesia and sedation in cardiac surgery and for cardiac patients undergoing non-cardiac surgery: a systematic-narrative hybrid review. Minerva Anestesiol. 2024;90(7–8):682–693. doi:10.23736/S0375-9393.24.17943-6

    26. Monaco F, Bottussi A, Barucco G, D’Andria UJ. Remimazolam in Cardiac Anesthesia: not So “Ultra-short Acting” After All. J Cardiothorac Vasc Anesth. 2025;39(1):327–328. doi:10.1053/j.jvca.2024.10.008

    27. Zhang H, Li H, Zhao S, Bao F. Remimazolam in General Anesthesia: a Comprehensive Review of Its Applications and Clinical Efficacy. Drug Des Devel Ther. 2024;18:3487–3498. doi:10.2147/dddt.S474854

    28. Aldecoa C, Bettelli G, Bilotta F, et al. European Society of Anaesthesiology evidence-based and consensus-based guideline on postoperative delirium. Eur J Anaesthesiol. 2017;34(4):192–214. doi:10.1097/eja.0000000000000594

    29. Brown EN, Lydic R, Schiff ND. General anesthesia, sleep, and coma. N Engl J Med. 2010;363(27):2638–2650. doi:10.1056/NEJMra0808281

    30. Obert DP, Hight D, Sleigh J, et al. The First Derivative of the Electroencephalogram Facilitates Tracking of Electroencephalographic Alpha Band Activity During General Anesthesia. Anesth Analg. 2022;134(5):1062–1071. doi:10.1213/ane.0000000000005783

    31. Muhlhofer WG, Zak R, Kamal T, et al. Burst-suppression ratio underestimates absolute duration of electroencephalogram suppression compared with visual analysis of intraoperative electroencephalogram. Br J Anaesth. 2017;118(5):755–761. doi:10.1093/bja/aex054

    32. Reese M, Christensen S, Anolick H, et al. EEG pre-burst suppression: characterization and inverse association with preoperative cognitive function in older adults. Front Aging Neurosci. 2023;15:1229081. doi:10.3389/fnagi.2023.1229081

    33. Hshieh TT, Saczynski J, Gou RY, et al. Trajectory of Functional Recovery After Postoperative Delirium in Elective Surgery. Ann Surg. 2017;265(4):647–653. doi:10.1097/sla.0000000000001952

    34. Vasunilashorn SM, Fong TG, Albuquerque A, et al. Delirium Severity Post-Surgery and its Relationship with Long-Term Cognitive Decline in a Cohort of Patients without Dementia. J Alzheimers Dis. 2018;61(1):347–358. doi:10.3233/jad-170288

    35. Trudell JR, Bertaccini E, Maciver MB. Teaching an old GABA receptor new tricks. Anesth Analg. 2012;115(2):270–273. doi:10.1213/ANE.0b013e31824a0b3c

    36. Newman MF, Murkin JM, Roach G, et al. Cerebral physiologic effects of burst suppression doses of propofol during nonpulsatile cardiopulmonary bypass. CNS Subgroup of McSPI. Anesth Analg. 1995;81(3):452–457. doi:10.1097/00000539-199509000-00004

    37. Cheng VY, Martin LJ, Elliott EM, et al. Alpha5GABAA receptors mediate the amnestic but not sedative-hypnotic effects of the general anesthetic etomidate. J Neurosci. 2006;26(14):3713–3720. doi:10.1523/jneurosci.5024-05.2006

    38. Chan MT, Cheng BC, Lee TM, Gin T. BIS-guided anesthesia decreases postoperative delirium and cognitive decline. J Neurosurg Anesthesiol. 2013;25(1):33–42. doi:10.1097/ANA.0b013e3182712fba

    39. Radtke FM, Franck M, Lendner J, Krüger S, Wernecke KD, Spies CD. Monitoring depth of anaesthesia in a randomized trial decreases the rate of postoperative delirium but not postoperative cognitive dysfunction. Br J Anaesth. 2013;110(Suppl 1):i98–105. doi:10.1093/bja/aet055

    40. Whitlock EL, Torres BA, Lin N, et al. Postoperative delirium in a substudy of cardiothoracic surgical patients in the BAG-RECALL clinical trial. Anesth Analg. 2014;118(4):809–817. doi:10.1213/ane.0000000000000028

    41. Bae MI, Bae J, Song Y, Kim M, Han DW. Comparative Analysis of the Performance of Electroencephalogram Parameters for Monitoring the Depth of Sedation During Remimazolam Target-Controlled Infusion. Anesth Analg. 2024;138(6):1295–1303. doi:10.1213/ANE.0000000000006718

    42. Huang X, Cao H, Zhang C, et al. The difference in mean arterial pressure induced by remimazolam compared to etomidate in the presence of fentanyl at tracheal intubation: a randomized controlled trial. Front Pharmacol. 2023;14:1143784. doi:10.3389/fphar.2023.1143784

    43. Zong J, Yuan P, Zhang R, Wu S, Liu M, Qu L. Effect of remimazolam tosylate on the response to endotracheal intubation under general anesthesia in patients undergoing catheter placement for peritoneal dialysis. Am J Transl Res. 2025;17(2):974–982. doi:10.62347/XWSD5681

    44. Hu B, Zhang M, Wu Z, et al. Comparison of Remimazolam Tosilate and Etomidate on Hemodynamics in Cardiac Surgery: a Randomised Controlled Trial. Drug Des Devel Ther. 2023;17:381–388. doi:10.2147/DDDT.S401969

    45. Sieber F, Neufeld KJ, Gottschalk A, et al. Depth of sedation as an interventional target to reduce postoperative delirium: mortality and functional outcomes of the Strategy to Reduce the Incidence of Postoperative Delirium in Elderly Patients randomised clinical trial. Br J Anaesth. 2019;122(4):480–489. doi:10.1016/j.bja.2018.12.021

    46. Oh ES, Fong TG, Hshieh TT, Inouye SK. Delirium in Older Persons: advances in Diagnosis and Treatment. JAMA. 2017;318(12):1161–1174. doi:10.1001/jama.2017.12067

    47. Ge RL, Pejo E, Haburcak M, Husain SS, Forman SA, Raines DE. Pharmacological studies of methoxycarbonyl etomidate’s carboxylic acid metabolite. Anesth Analg. 2012;115(2):305–308. doi:10.1213/ANE.0b013e318239c6ca

    48. Wiltshire HR, Kilpatrick GJ, Tilbrook GS, Borkett KM. A placebo- and midazolam-controlled Phase I single ascending-dose study evaluating the safety, pharmacokinetics, and pharmacodynamics of remimazolam (CNS 7056): part II. Population pharmacokinetic and pharmacodynamic modeling and simulation. Anesth Analg. 2012;115(2):284–296. doi:10.1213/ANE.0b013e318241f68a

    49. Antonik LJ, Goldwater DR, Kilpatrick GJ, Tilbrook GS, Borkett KM. A placebo- and midazolam-controlled phase I single ascending-dose study evaluating the safety, pharmacokinetics, and pharmacodynamics of remimazolam (CNS 7056): part I. Safety, efficacy, and basic pharmacokinetics. Anesth Analg. 2012;115(2):274–283. doi:10.1213/ANE.0b013e31823f0c28

    50. Ingrande J, Lemmens HJ. Dose adjustment of anaesthetics in the morbidly obese. Br J Anaesth. 2010;105(Suppl 1):i16–23. doi:10.1093/bja/aeq312

    Continue Reading

  • Hollow Knight: Silksong Players on Nintendo Switch Can Unlock ‘Enhanced’ Switch 2 Features for Free

    Hollow Knight: Silksong Players on Nintendo Switch Can Unlock ‘Enhanced’ Switch 2 Features for Free

    Players jumping into Hollow Knight: Silksong on Nintendo Switch will be able to upgrade to the “enhanced” Switch 2 version for free.

    That comes from Team Cherry itself, which explained in an update on Kickstarter that while OG Nintendo Switch keys will be delivered directly to backers via email, Switch 2 players will need to download the Silksong Upgrade Pack from the eShop to unlock “enhanced features” (thanks, Eurogamer).

    “For Nintendo Switch 2 players, after redeeming your Nintendo Switch key and downloading the game, you will additionally need to download the (free) Hollow Knight: Silksong Upgrade Pack from the eShop to unlock the platform’s enhanced features,” Team Cherry advised.

    Though not explicitly confirmed, this suggests the upgrade pack will be available to all Silksong fans playing on Switch 2, regardless of backer status.

    Backer surveys close later today, so if you backed the team on Kickstarter, you have just hours to get your survey completed to get your game key, so don’t hang around!

    “I didn’t receive a survey, but I would honestly prefer to buy the game to support you guys anyway,” commented one happy player. “It has been so long that I actually forgot I was a backer of the original! Congrats on finally getting here Team Cherry!”

    Hollow Knight: Silksong will retail for just $19.99. Yes, really. While there were a lot of rumors over the last few days — including a $20 price on Gamestop (since removed) that was later corroborated by noted leaker Billbil-kun — developer Team Cherry has now confirmed it, revealing the game will retail for $19.99 in the U.S., €19.99 in Europe, and ¥2300 in Japan.

    Team Cherry finally revealed a release date for the long-awaited Hollow Knight: Silksong at gamescom: September 4, 2025. Expect loads of new insectoid NPCs, dreary graveyards, swamps, a bustling city, new enemies, new bosses, an Ori-style escape sequence, and more. It’ll be available on PC, Switch, Switch 2, PS4, PS5, Xbox One, and Xbox Series X and S. Check out the Hollow Knight: Silksong global release times to find out when the game will be available in your timezone.

    We tried out two levels from the Hollow Knight Silksong demo at gamescom 2025, Moss Grotto and Deep Docks. One was easy, and one was very challenging, but does it live up to the hype? Find out in our Hollow Knight: Silksong preview from the show floor.

    If you’re playing (or replaying) Hollow Knight before Silksong, take a look at IGN’s newly refreshed Hollow Knight walkthrough and detailed Hollow Knight interactive map to make sure you don’t miss any collectible locations.

    Vikki Blake is a reporter for IGN, as well as a critic, columnist, and consultant with 15+ years experience working with some of the world’s biggest gaming sites and publications. She’s also a Guardian, Spartan, Silent Hillian, Legend, and perpetually High Chaos. Find her at BlueSky.

Continue Reading

  • Williams in the News: Points, Penalties and Podiums

    Williams in the News: Points, Penalties and Podiums

    Formula 1 returned from the summer break with a dramatic Dutch Grand Prix, and now all eyes turn to Monza.

    Here’s a round-up of the latest stories.

    Albon: “A perfect race”

    Alex Albon charged through the field in Zandvoort, climbing from P15 on the grid to finish in a superb fifth place. Speaking to F1.com afterwards, he credited a strong start and calm execution amid the chaos.

    “I think today was a perfect race. We had a really strong start and then there was a lot of crashes that helped us. I don’t know why there was so much chaos, but we kept it clean and had a good race.

    “We were hoping for rain, and in terms of race strategy it didn’t look like it was going to be a fun race at all, but I think we made it for ourselves with that strong start.

    “By being P10 by Lap 1, it put us in contention for the rest of the race. We kept it on track and picked up the pieces of what went on around us and got that P5.”

    BE OUR VEGAS VIP

    This is your chance to win an unforgettable VIP getaway to the 2025 Las Vegas Grand Prix!

    Carlos: “A complete joke”

    Carlos Sainz’s race in Zandvoort ended without points after a 10-second penalty was handed down for contact with Liam Lawson. Speaking to ESPN, Carlos was forthright in his view of the decision.

    “I think it’s a complete joke. Honestly, I need to go now to the stewards just to get an explanation to see what is their point of view of the incident because it’s unacceptable.

    “I think it’s not the level of the stewards in Formula 1 if they are really considering that to be a 10-second penalty on my behalf. I think it’s a serious matter now that concerns me as a driver, as a GPDA director and something that I will make sure I raise.”

    Block Breaks Through

    Lia Block secured her first podium in the series last weekend, sharing her reflections with F1 Academy after what she described as a “long time coming.”

    “It’s been a long time coming,” she admitted. “Singapore last year was so close in that first race, so I feel relieved to be here. Just happy for the team as well, we got to grab some good points.

    “It was a clean race. Maya and I had a good battle in the last two laps, my rear tyres were going so I’m really happy to be here and I hope we keep this momentum going into the next race this weekend.”

    She also spoke about her progress as a driver and the determination behind her result.

    “I’ve matured, that’s for sure. As a driver and as a person. It’s been a long two years and a season and a half so far. It’s been a struggle, honestly we did not start the season the way we wanted it to. Unlucky stuff has happened one after another, so I’m really glad to be turning that luck around and this is the redemption arc.”

    DRIVER CARD 2025

    Claim and customise your free pass to the world of Atlassian Williams Racing!

    Bondarev’s First Italian F4 Victory

    Williams Driver Academy member Oleksandr Bondarev claimed his first Italian F4 win earlier in August at Imola, telling the BBC how he and his team turned things around.

    “We struggled with getting a clean weekend together for a big part of the season just due to driving mistakes and some moments of bad luck,” he said.

    “It took a lot of analysing and understanding what I could do better as a driver.

    “A lot of work was also done with my engineer and with the whole of the Prema team and, in the end, that brought the result.”

    The Ukrainian driver also spoke about the powerful support from home, where the support “has been amazing over the year”, he said.

    “To finally get the result and to see how well they reacted to that has been a really nice feeling.

    “These little boosts when the Ukrainian athletes perform really well is what helps cheer them up at least a little bit.

    “I’m trying to win for my country as well.”

    Continue Reading