Category: 3. Business

The United Arab Emirates has established a sophisticated legal framework for financial restructuring and bankruptcy, most recently embodied in Federal Decree Law No. 51 of 2023 (the Insolvency Law). The Insolvency Law is not only a technical instrument addressing debtor and creditor interests but also a legislative tool designed to protect the broader public interest and uphold public order. The concept of public order is deeply embedded in UAE law, including its Constitution and judicial practice, and plays a decisive role in shaping the application and interpretation of bankruptcy proceedings.

Public order in the UAE legal system

Public order in the UAE is a foundational legal principle, referenced explicitly in the Constitution and often invoked by the courts. Article 44 of the UAE Constitution states that “respect of the Constitution, the laws and the orders issued by the public authorities in execution thereof, compliance with the public order, and respect of public moral are duties binding to all the people living in the UAE.“

Public order is understood as encompassing the ultimate interests of society and the ethical, economic, and political foundations of the state.

The UAE’s bankruptcy law is expressly recognised as a matter of public order. The Abu Dhabi Court of Cassation has affirmed that the rules and procedures governing bankruptcy are not merely contractual or private in nature but are mandatory provisions that serve the collective interests of society. In a landmark 2024 decision, the court annulled an arbitral award that conflicted with bankruptcy proceedings, ruling that the exclusive jurisdiction of bankruptcy courts and the mandatory nature of bankruptcy procedures are integral to public order. The court stated that public order is “one of the essential safeguards the respect of which is a priority in all acts and judgments, for it is relating to the ultimate interest of the society and to the social or political or economic or ethical basis on which the State is founded“. 

Balancing private and public interests

The Insolvency Law articulates clear objectives that go beyond the interests of debtors and creditors in assisting debtors in settling debts and preserving the rights of creditors. The law aims to maintain the vitality of the national economy and protect jobs and maintain business continuity.

These objectives reflect a legislative intent to balance private interests with the protection of the credit system and the broader public interest. The law empowers courts to exercise discretion when assessing public order, such as by authorising selective payments to critical suppliers or employees when necessary to prevent greater social costs.

In practice, the concept of public interest operates as a governing standard throughout bankruptcy proceedings. Courts, trustees, and creditors are required to consider the broader economic and social impact of their decisions at every stage, including at the following stages:

1. Commencement of proceedings: Courts assess whether starting bankruptcy proceedings will stabilise wages, supply chains, and affect a group of creditors.
2. Reorganisation vs. liquidation: The law mandates a careful assessment of job preservation and the social consequences of liquidation.
3. Assessment of critical suppliers and wages: Exceptions to the pari passu principle (equal treatment of creditors) are permitted when justified by public interest.
4. Approval of plans: Reorganisation plans must demonstrate feasibility, fairness, and visible public benefits, such as job preservation and market stability. 

The UAE judiciary has consistently enforced the public order nature of bankruptcy law. For example, the Abu Dhabi Court of Cassation annulled an arbitral award that conflicted with bankruptcy proceedings, emphasising that bankruptcy court jurisdiction is exclusive and mandatory, and that arbitration agreements are inoperative in bankruptcy cases.

Conclusion

Bankruptcy law in the UAE is not merely a set of private rules that governs the interests of debtors and creditors but a public order regime designed to protect economic stability, market confidence, and the interests of society as a whole. Courts, trustees, and creditors are all bound to act in accordance with public order, ensuring that bankruptcy proceedings serve not only the parties involved but also the broader public good.

Exploring clinical development plan options including a controlled human infection model (CHIM) and a Phase 2/3 adaptive field study

Expect to have investigational product of TNX-4800 (anti-Borrelia OspA mAb) available for clinical trials in early 2027

Approximately 70 million people that live, work or vacation in areas of the U.S. in which Lyme disease is endemic could potentially benefit from pre-exposure prophylaxis

CHATHAM, N.J., Dec. 29, 2025 (GLOBE NEWSWIRE) — Tonix Pharmaceuticals Holding Corp. (Nasdaq: TNXP) (“Tonix” or the “Company”), a fully-integrated commercial stage biotechnology company, today announced program updates on TNX-4800 (formerly known as mAb 2217LS)^1,2, which is a long-acting human monoclonal antibody (mAb) that targets the outer surface protein A (OspA) of Borrelia burgdorferi, the causative agent of Lyme disease in humans. TNX-4800 is being developed for annual seasonal use, as one subcutaneous administration in the spring to protect against Lyme disease through fall, or the entire tick season in the U.S. There are no currently marketed U.S. Food and Drug Administration (FDA)-approved vaccines or prophylactics to protect against Lyme disease.

“We plan to meet with the FDA in 2026 to explore Phase 2/3 development options,” said Seth Lederman, M.D., Chief Executive Officer of Tonix Pharmaceuticals. “We believe a controlled human infection model (CHIM)^3-5 study using Borrelia-infected ticks that mimics natural infection would be a potential path to demonstrating TNX-4800 efficacy for approval. We are on a path to have investigational product produced under Good Manufacturing Practices (GMP) available for testing early in 2027. We believe TNX-4800’s long-acting mAb prophylaxis could play an important role for preventing Lyme for millions of people who live, work, and vacation in regions endemic for Lyme disease. TNX-4800 provides near-immediate immunity to the bacteria that cause Lyme disease after a single administration, which is very different from Lyme disease vaccine programs currently in development. Prophylaxis with TNX-4800 may also avoid the limitations of vaccine products designed to actively immunize against Lyme, including suboptimal immune responses from age, immunocompetence, and other reasons.”

About TNX-4800
TNX-4800 (formerly known as mAb 2217LS) is a fully human monoclonal antibody with an engineered extended half-life that targets the outer-surface protein A (OspA) on Lyme-causing Borrelia bacteria. By binding OspA when TNX-4800 containing blood is ingested by the tick, TNX-4800 kills and blocks the maturation of Borrelia burgdorferi in the mid-gut of infected deer ticks. Published work in non-human primates showed that TNX-4800 was 95% effective in preventing infection after 6 days of exposure to ticks infected with Borrelia burgdorferi.¹ TNX-4800 was derived from mAb 2217 by amino acid substitutions in its crystallizable fragment (Fc) domain which served to prolong the serum half-life. A single administration in the Spring is designed to provide immunity within two days and maintain protective antibody titers for the entire tick season, providing pre-exposure prophylaxis against Lyme disease without relying on the recipient’s immune system to generate antibodies. By delivering a well-characterized antibody directly, TNX-4800 has been shown to block transmission of the major Borrelia genospecies from ticks to animals. TNX-4800 also sidesteps the multidose schedules required for OspA vaccines in development⁶ and FDA-approved vaccines that have been withdrawn from the market due to concerns about increased risk of autoimmunity.⁷ Tonix intends to advance TNX-4800 through additional clinical trials with the goal of submitting a Biologics Licensing Application (BLA) to the FDA.

About TNX-4800 Pharmacokinetics
TNX-4800 was studied in a randomized, double-blind, sequential dose-escalation study (NCT04863287) that evaluated safety, tolerability, pharmacokinetics (PK), and immunogenicity of TNX-4800 in healthy adults. Forty-four subjects were randomized and 41 completed the study. Subjects received a single subcutaneous (SC) administration of placebo or TNX-4800 at 0.5, 1.5, 5, or 10 mg/kg. Safety was assessed via clinical and lab evaluations. Drug exposure increased by approximately 25-times for a 20-times increase in dose. Serum TNX-4800 was measurable at the earliest sampling time of 24 hours, indicating rapid systemic absorption. TNX-4800 concentrations remained quantifiable for >200 days in 80% of volunteers at the lowest dose and for up to 350 days in the majority of volunteers at higher doses (i.e., ≥ 1.5 mg/kg). Mean half-life ranged from 62–69 days across groups. Serum concentrations remained quantifiable for up to 12 months in most subjects. Mean exposure for the 10 mg/kg cohort was less than 20% of the highest exposures in a rat toxicology study. Anti-drug antibodies (ADA) were detected in <10% of treated subjects, with no impact on PK. Most adverse events were mild or moderate. TNX-4800 was determined to be generally safe and well tolerated.

About Lyme Disease 
In the United States, Lyme disease is caused by the bacterium Borrelia burgdorferi. Lyme disease remains the most common vector-borne infection in the United States and its incidence is climbing each year.⁸ It occurs most commonly in the Northeast, mid-Atlantic, and upper-Midwest regions. Lyme disease bacteria are transmitted through the bite of infected Ixodes ticks. Typical symptoms include fever, headache, fatigue, and a characteristic skin rash called erythema migrans. If left untreated, infection can spread to joints, the heart, and the nervous system. Laboratory testing is helpful if used correctly and performed with FDA-cleared tests. Although many cases of Lyme disease can be treated successfully with antibiotics, diagnosis and treatment are often delayed or missed, and even with treatment, up to 20% of cases may progress to a Post-Treatment Lyme Disease Syndrome (PTLDS) called “Chronic Lyme” or “Long Lyme”. Chronic Lyme is considered an Infection Associated Chronic Illness (IACI), and is a chronic, debilitating disease state characterized by joint and muscle pain, fatigue and other symptoms.⁹

About Borrelia Burgdorferi
In infected deer ticks, Borrelia’s OspA lipoprotein binds to tick-gut receptor TROSPA and helps it adhere to the midgut lining. During a tick bite blood meal, Borrelia downregulates OspA, upregulates OspC, and activates motility genes. Borrelia undergoes a metamorphic-like transformation, becoming highly flagellated and mobile, which facilitates migration to the tick salivary glands and invasion of human host tissues. During a tick bite of an animal pre-treated with TNX-4800, the tick ingests host blood containing TNX-4800, which kills and blocks the metamorphic-like transformation of Borrelia in the tick’s midgut preventing transmission of the bacteria. Lyme-causing Borrelia-exposed or -infected individuals, rarely make antibodies against OspA which allows for people to be reinfected despite having immunity to OspC. Consequently, we expect that protection against Borrelia would require annual prophylaxis with TNX-4800.

About Monoclonal Antibody Prophylaxis
Two long-acting monoclonal antibody products^10,11 have won FDA approval for prophylaxis against respiratory syncytial virus (RSV). AstraZeneca (in partnership with Sanofi) markets Beyfortus™ (nirsevimab) and Merck markets Enflonsia™ (clesrovimab).

Tonix Pharmaceuticals Holding Corp.*
Tonix Pharmaceuticals is a fully-integrated biotechnology company with marketed products and a pipeline of development candidates. Tonix markets FDA-approved TONMYA^TM, a first-in-class, non-opioid analgesic medicine for the treatment of fibromyalgia, a chronic pain condition that affects millions of adults. TONMYA is the first new prescription medicine approved by the FDA for fibromyalgia in more than 15 years. TONMYA was investigated as TNX-102 SL. Tonix also markets two treatments for acute migraine in adults: Zembrace® SymTouch® (sumatriptan injection) and Tosymra® (sumatriptan nasal spray). Tonix’s development portfolio* is focused on central nervous system (CNS) disorders, immunology, immuno-oncology, rare disease and infectious disease. TNX-102 SL is being developed to treat acute stress reaction and acute stress disorder under an Investigator-Initiated IND at the University of North Carolina in the OASIS study funded by the U.S. Department of Defense (DoD). TNX-102 SL is also in development for major depressive disorder. Tonix’s immunology development portfolio consists of biologics to address organ transplant rejection, autoimmunity and cancer, including TNX-1500, which is a Phase 2- ready Fc-modified humanized monoclonal antibody targeting CD40-ligand (CD40L or CD154) being developed for the prevention of allograft rejection and for the treatment of autoimmune diseases. Tonix’s rare disease portfolio includes TNX-2900, intranasal oxytocin potentiated with magnesium, in development for Prader-Willi syndrome and expected to start a potential pivotal Phase 2 study in 2026. Tonix’s infectious disease portfolio includes TNX-801, a vaccine in development for mpox and smallpox, as well as TNX-4800, a Phase 2- ready long-acting humanized monoclonal antibody for the seasonal prevention of Lyme disease. Finally, TNX-4200 for which Tonix has a contract with the U.S. DoD’s Defense Threat Reduction Agency (DTRA) for up to $34 million over five years, is a small molecule broad-spectrum antiviral agent targeting CD45 for the prevention or treatment of high lethality infections to improve the medical readiness of military personnel in biological threat environments. Tonix owns and operates a state-of-the art infectious disease research facility in Frederick, Md
* Tonix’s product development candidates are investigational new drugs or biologics; their efficacy and safety have not been established and have not been approved for any indication.

This press release and further information about Tonix can be found at www.tonixpharma.com.

Citations

¹Schiller ZA, et al. J Clin Invest. 2021 131(11):e144843.

²Wang Y, et al. J Infect Dis. 2016. 214(2):205-11.

³Cavaleri M, et al.. Biologicals. 2024. 85:101745.

⁴Abo YN, et al.. Lancet Infect Dis. 2023. 23(12):e533-e546.

⁵Ramanathan R, et al.. Vaccine. 2019 Jul 18;37(31):4256-4261.

⁶Comstedt P, et al. Vaccine. 2015 33(44):5982-8.

⁷Connaught’s (ImuLyme™) and SmithKline Beecham’s (LYMErix™) Lyme disease vaccines were withdrawn over concerns about an increased risk of autoimmune arthritis triggered by molecular mimicry, particularly in HLADRB1*0401 (“DR4+”) individuals. Nigrovic LE, et al. Epidemiol Infect. 2007 135(1):1-8. doi: 10.1017/S0950268806007096. Epub 2006 Aug 8. PMID: 16893489; PMCID: PMC2870557.

⁸Gomes-Solecki M, et. al. Clin Infect Dis. 2020 70(8):1768-1773. doi: 10.1093/cid/ciz872. PMID: 31620776; PMCID: PMC7155782.

⁹National Academies of Sciences, Engineering, and Medicine. 2025. Charting a Path Toward New Treatments for Lyme Infection-Associated Chronic Illnesses. Washington, DC: The National Academies Press. https://doi.org/10.17226/28578.

¹⁰May 29, 2025. Sanofi Press Release. “Beyfortus public health advantage bolstered by first real-world comparison of infant vs maternal RSV immunization programs.” https://bit.ly/40DeJGf

¹¹June 9, 2025. Merck Press Release. “U.S. FDA Approves Merck’s ENFLONSIA™ (clesrovimab-cfor) for Prevention of Respiratory Syncytial Virus (RSV) Lower Respiratory Tract Disease in Infants Born During or Entering Their First RSV Season” https://bit.ly/4kkXDE8.

Forward Looking Statements
Certain statements in this press release are forward-looking within the meaning of the Private Securities Litigation Reform Act of 1995. These statements may be identified by the use of forward-looking words such as “anticipate,” “believe,” “forecast,” “estimate,” “expect,” and “intend,” among others. These forward-looking statements are based on Tonix’s current expectations and actual results could differ materially. There are a number of factors that could cause actual events to differ materially from those indicated by such forward-looking statements. These factors include, but are not limited to, risks related to the failure to successfully launch and commercialize TONMYA and any of our approved products; risks related to the failure to obtain FDA clearances or approvals and noncompliance with FDA regulations; risks related to the timing and progress of clinical development of our product candidates; our need for additional financing; uncertainties of patent protection and litigation; uncertainties of government or third party payor reimbursement; limited research and development efforts and dependence upon third parties; and substantial competition. As with any pharmaceutical under development, there are significant risks in the development, regulatory approval and commercialization of new products. Tonix does not undertake an obligation to update or revise any forward-looking statement. Investors should read the risk factors set forth in the Annual Report on Form 10-K for the year ended December 31, 2024, as filed with the Securities and Exchange Commission (the “SEC”) on March 18, 2025, and periodic reports filed with the SEC on or after the date thereof. All of Tonix’s forward-looking statements are expressly qualified by all such risk factors and other cautionary statements. The information set forth herein speaks only as of the date thereof.

Investor Contacts
Jessica Morris
Tonix Pharmaceuticals 
investor.relations@tonixpharma.com 
(862) 799-8599 

Brian Korb 
astr partners 
(917) 653-5122 
brian.korb@astrpartners.com 

Media Contacts
Mary Ann Ondish
Tonix Pharmaceuticals
maryann.ondish@tonixpharma.com

Ray Jordan 
Putnam Insights 
ray@putnaminsights.com 
 

INDICATION
TONMYA is indicated for the treatment of fibromyalgia in adults.

CONTRAINDICATIONS
TONMYA is contraindicated:
In patients with hypersensitivity to cyclobenzaprine or any inactive ingredient in TONMYA. Hypersensitivity reactions may manifest as an anaphylactic reaction, urticaria, facial and/or tongue swelling, or pruritus. Discontinue TONMYA if a hypersensitivity reaction is suspected.
With concomitant use of monoamine oxidase (MAO) inhibitors or within 14 days after discontinuation of an MAO inhibitor. Hyperpyretic crisis seizures and deaths have occurred in patients who received cyclobenzaprine (or structurally similar tricyclic antidepressants) concomitantly with MAO inhibitors drugs.

During the acute recovery phase of myocardial infarction, and in patients with arrhythmias, heart block or conduction disturbances, or congestive heart failure.
In patients with hyperthyroidism.

WARNINGS AND PRECAUTIONS
Embryofetal toxicity: Based on animal data, TONMYA may cause neural tube defects when used two weeks prior to conception and during the first trimester of pregnancy. Advise females of reproductive potential of the potential risk and to use effective contraception during treatment and for two weeks after the final dose. Perform a pregnancy test prior to initiation of treatment with TONMYA to exclude use of TONMYA during the first trimester of pregnancy.

Serotonin syndrome: Concomitant use of TONMYA with selective serotonin reuptake inhibitors (SSRIs), serotonin norepinephrine reuptake inhibitors (SNRIs), tricyclic antidepressants, tramadol, bupropion, meperidine, verapamil, or MAO inhibitors increases the risk of serotonin syndrome, a potentially life-threatening condition. Serotonin syndrome symptoms may include mental status changes, autonomic instability, neuromuscular abnormalities, and/or gastrointestinal symptoms. Treatment with TONMYA and any concomitant serotonergic agent should be discontinued immediately if serotonin syndrome symptoms occur and supportive symptomatic treatment should be initiated. If concomitant treatment with TONMYA and other serotonergic drugs is clinically warranted, careful observation is advised, particularly during treatment initiation or dosage increases.
Tricyclic antidepressant-like adverse reactions: Cyclobenzaprine is structurally related to TCAs. TCAs have been reported to produce arrhythmias, sinus tachycardia, prolongation of the conduction time leading to myocardial infarction and stroke. If clinically significant central nervous system (CNS) symptoms develop, consider discontinuation of TONMYA. Caution should be used when TCAs are given to patients with a history of seizure disorder, because TCAs may lower the seizure threshold. Patients with a history of seizures should be monitored during TCA use to identify recurrence of seizures or an increase in the frequency of seizures.

Atropine-like effects: Use with caution in patients with a history of urinary retention, angle-closure glaucoma, increased intraocular pressure, and in patients taking anticholinergic drugs.

CNS depression and risk of operating a motor vehicle or hazardous machinery: TONMYA monotherapy may cause CNS depression. Concomitant use of TONMYA with alcohol, barbiturates, or other CNS depressants may increase the risk of CNS depression. Advise patients not to operate a motor vehicle or dangerous machinery until they are reasonably certain that TONMYA therapy will not adversely affect their ability to engage in such activities.
Oral mucosal adverse reactions: In clinical studies with TONMYA, oral mucosal adverse reactions occurred more frequently in patients treated with TONMYA compared to placebo. Advise patients to moisten the mouth with sips of water before administration of TONMYA to reduce the risk of oral sensory changes (hypoesthesia). Consider discontinuation of TONMYA if severe reactions occur.

ADVERSE REACTIONS
The most common adverse reactions (incidence ≥2% and at a higher incidence in TONMYA-treated patients compared to placebo-treated patients) were oral hypoesthesia, oral discomfort, abnormal product taste, somnolence, oral paresthesia, oral pain, fatigue, dry mouth, and aphthous ulcer.

DRUG INTERACTIONS

MAO inhibitors: Life-threatening interactions may occur.

Other serotonergic drugs: Serotonin syndrome has been reported.

CNS depressants: CNS depressant effects of alcohol, barbiturates, and other CNS depressants may be enhanced.

Tramadol: Seizure risk may be enhanced.
Guanethidine or other similar acting drugs: The antihypertensive action of these drugs may be blocked.

USE IN SPECIFIC POPULATIONS
Pregnancy: Based on animal data, TONMYA may cause fetal harm when administered to a pregnant woman. The limited amount of available observational data on oral cyclobenzaprine use in pregnancy is of insufficient quality to inform a TONMYA-associated risk of major birth defects, miscarriage, or adverse maternal or fetal outcomes. Advise pregnant women about the potential risk to the fetus with maternal exposure to TONMYA and to avoid use of TONMYA two weeks prior to conception and through the first trimester of pregnancy. Report pregnancies to the Tonix Medicines, Inc., adverse-event reporting line at 1-888-869-7633 (1-888-TNXPMED).

Lactation: A small number of published cases report the transfer of cyclobenzaprine into human milk in low amounts, but these data cannot be confirmed. There are no data on the effects of cyclobenzaprine on a breastfed infant, or the effects on milk production. The developmental and health benefits of breastfeeding should be considered along with the mother’s clinical need for TONMYA and any potential adverse effects on the breastfed child from TONMYA or from the underlying maternal condition.

Pediatric use: The safety and effectiveness of TONMYA have not been established.
Geriatric patients: Of the total number of TONMYA-treated patients in the clinical trials in adult patients with fibromyalgia, none were 65 years of age and older. Clinical trials of TONMYA did not include sufficient numbers of patients 65 years of age and older to determine whether they respond differently from younger adult patients.

Hepatic impairment: The recommended dosage of TONMYA in patients with mild hepatic impairment (HI) (Child Pugh A) is 2.8 mg once daily at bedtime, lower than the recommended dosage in patients with normal hepatic function. The use of TONMYA is not recommended in patients with moderate HI (Child Pugh B) or severe HI (Child Pugh C). Cyclobenzaprine exposure (AUC) was increased in patients with mild HI and moderate HI compared to subjects with normal hepatic function, which may increase the risk of TONMYA-associated adverse reactions.

Please see additional safety information in the full Prescribing Information.
To report suspected adverse reactions, contact Tonix Medicines, Inc. at 1-888-869-7633, or the FDA at 1-800-FDA-1088 or www.fda.gov/medwatch.

Indication and Usage
Zembrace^® SymTouch^® (sumatriptan succinate) injection (Zembrace) and Tosymra^® (sumatriptan) nasal spray are prescription medicines used to treat acute migraine headaches with or without aura in adults who have been diagnosed with migraine.
Zembrace and Tosymra are not used to prevent migraines. It is not known if Zembrace or Tosymra are safe and effective in children under 18 years of age.

Important Safety Information
Zembrace and Tosymra can cause serious side effects, including heart attack and other heart problems, which may lead to death. Stop use and get emergency help if you have any signs of a heart attack:

• discomfort in the center of your chest that lasts for more than a few minutes or goes away and comes back
• severe tightness, pain, pressure, or heaviness in your chest, throat, neck, or jaw
• pain or discomfort in your arms, back, neck, jaw or stomach
• shortness of breath with or without chest discomfort
• breaking out in a cold sweat
• nausea or vomiting
• feeling lightheaded

Zembrace and Tosymra are not for people with risk factors for heart disease (high blood pressure or cholesterol, smoking, overweight, diabetes, family history of heart disease) unless a heart exam shows no problem.
Do not use Zembrace or Tosymra if you have:

• history of heart problems
• narrowing of blood vessels to your legs, arms, stomach, or kidney (peripheral vascular disease)
• uncontrolled high blood pressure
• hemiplegic or basilar migraines. If you are not sure if you have these, ask your provider.
• had a stroke, transient ischemic attacks (TIAs), or problems with blood circulation
• severe liver problems
• taken any of the following medicines in the last 24 hours: almotriptan, eletriptan, frovatriptan, naratriptan, rizatriptan, ergotamines, or dihydroergotamine. Ask your provider for a list of these medicines if you are not sure.
• are taking certain antidepressants, known as monoamine oxidase (MAO)-A inhibitors or it has been 2 weeks or less since you stopped taking a MAO-A inhibitor. Ask your provider for a list of these medicines if you are not sure.
• an allergy to sumatriptan or any of the components of Zembrace or Tosymra

Tell your provider about all of your medical conditions and medicines you take, including vitamins and supplements.

Zembrace and Tosymra can cause dizziness, weakness, or drowsiness. If so, do not drive a car, use machinery, or do anything where you need to be alert.

Zembrace and Tosymra may cause serious side effects including:

• changes in color or sensation in your fingers and toes
• sudden or severe stomach pain, stomach pain after meals, weight loss, nausea or vomiting, constipation or diarrhea, bloody diarrhea, fever
• cramping and pain in your legs or hips; feeling of heaviness or tightness in your leg muscles; burning or aching pain in your feet or toes while resting; numbness, tingling, or weakness in your legs; cold feeling or color changes in one or both legs or feet
• increased blood pressure including a sudden severe increase even if you have no history of high blood pressure
• medication overuse headaches from using migraine medicine for 10 or more days each month. If your headaches get worse, call your provider.
• serotonin syndrome, a rare but serious problem that can happen in people using Zembrace or Tosymra, especially when used with anti-depressant medicines called SSRIs or SNRIs. Call your provider right away if you have: mental changes such as seeing things that are not there (hallucinations), agitation, or coma; fast heartbeat; changes in blood pressure; high body temperature; tight muscles; or trouble walking.
• hives (itchy bumps); swelling of your tongue, mouth, or throat
• seizures even in people who have never had seizures before

The most common side effects of Zembrace and Tosymra include: pain and redness at injection site (Zembrace only); tingling or numbness in your fingers or toes; dizziness; warm, hot, burning feeling to your face (flushing); discomfort or stiffness in your neck; feeling weak, drowsy, or tired; application site (nasal) reactions (Tosymra only) and throat irritation (Tosymra only).

Tell your provider if you have any side effect that bothers you or does not go away. These are not all the possible side effects of Zembrace and Tosymra. For more information, ask your provider.

This is the most important information to know about Zembrace and Tosymra but is not comprehensive. For more information, talk to your provider and read the Patient Information and Instructions for Use. You can also visit https://www.tonixpharma.com or call 1-888-869-7633.

You are encouraged to report adverse effects of prescription drugs to the FDA. Visit www.fda.gov/medwatch, or call 1-800-FDA-1088.

This press release and further information about Tonix can be found at www.tonixpharma.com.

Source: Tonix Pharmaceuticals Holding Corp.

Released December 29, 2025

When it rains, what happens to the water once it enters the soil? Does the new precipitation mix with all of the water that was already there? In their recent paper in Water Resources Research, Department of Natural Resources and the Environment Ph.D. student Joshua Snarski and assistant professor James Knighton show the answer is more complicated than previously assumed, but knowing the age of water gives a more accurate picture.

Hydrologists use models to simulate what is happening in natural systems. Since hydrologic processes are complex, researchers need to make assumptions about some aspects, such as how water mixes within the soil profile. Though previous hydrologic research is focused on the amount and timing of precipitation, Snarski says shifting the focus to the age of water within the soil profile can reveal more about what is happening beneath the surface.

For this project, the researchers determined the age of water in the soil by looking at the stable water isotope compositions of soil water samples through time. Stable water isotopes are naturally abundant in the environment and do not interact with other elements within the system, Snarski explains, which makes them powerful tracers. Each rainstorm releases water with a unique isotope signature, allowing each precipitation event to be tracked.

“Precipitation acts as water inputs to the soil and assigning these ‘new’ water inputs with an age of zero days allows us to ‘start the clock’ on the soil water aging,” says Snarski. “We collect precipitation and soil water samples to create a record of the volume and isotope signature of both the new water entering the soil and the existing water within the soil.”

The researchers use these two water records to estimate the age of water in the soil profile over time. If you imagine a drop of rain traveling down through layers of soil, knowing the age of that water indicates its pace of movement, and that can provide insight into how water is stored within and released from soils. This information is especially crucial in agricultural settings, as farmers need to decide when and how much fertilizer to apply to fields to support crop growth.

The researchers focused on agricultural fields during the growing season, Snarski explains, which experience the most fertilizer applications and the dryest soil conditions, due to less precipitation and more water uptake by plants. This combination can lead to high concentrations of dissolved compounds in the soil water.

“When we see young water in deeper soil layers, we know that water is moving quickly and carrying with it dissolvable compounds, such as nutrients and pollutants,” says Snarski. “If dissolved nutrients move too quickly through the rooting zone, crops can’t access them, and they become a contamination risk for groundwater and surface waters. While fertilizers help farmers produce high crop yields, they pose a potential risk to nearby waterways. If excessive amounts of nutrients are quickly flushed to groundwater or transported with surface runoff, they can enter waterways and lead to eutrophication and hypoxia.”

Next, the researchers calibrated two hydrological models to their soil water volume and isotope tracing data to test the assumption that soil water mixes fully. The first model assumed new water mixed fully with old water in each soil layer, while the second model allowed new water to bypass old water under certain conditions.

“The second model separates the soil profile into two groups: small and large soil pores. Basically, the small pores hold water under high tension, but can be drained by plant water uptake, while the large pores can replenish the small pores or percolate to deeper soil layers,” says Snarski. “This simple separation of the soil by pore size allows for younger water in the large pores to bypass older water in the small pores.”

The full mixing model estimated that the average age of water leaving the rooting zone in the mid-summer months was between 35 and 40 days old. This was a big difference to the model that considered pore size, which estimated that the age of water leaving the rooting zone was 10 to 15 days old. The collected soil water volume and water isotope data indicated that the second model was more accurate and better reflected conditions in the field, says Snarski. The results indicate that young water can bypass older water and that full mixing assumptions need to be reconsidered in hydrologic models. It also emphasized the importance of tracer data along with the volume of water.

“Because we have this extra level of information, the concentration of stable water isotopes, we were able to estimate the age of water through the profile,” says Snarski. “If we were just measuring the amount of water in the soil, we wouldn’t know how long it’s been there, what pathways it traveled along, and which other sources of water its mixed with.”

Snarski was surprised by how quickly the water was flowing through the rooting zone. This means that dissolved nutrients applied just before or during the summer may only be accessible to crops for between one to two weeks before entering deeper soils. This is a big problem not only in terms of crop growth and fertilizer costs, but also presents a concern for drinking water contamination. Knowing how water flows through the soil is an important detail that can help make agricultural practices more efficient, and it can be used to improve hydrologic models. This work also illustrates the nuances in effective modeling, Snarski explains.

“George Box put it well when he said all models are wrong, but some are useful. To make models more realistic, you must account for more processes, which quickly adds complexity. More complex models require more input data and a more experienced modeler to use them,” says Snarski. “So, it comes down to a cost-benefit analysis. Does the improvement in the modeling results outweigh the cost of the added complexity? In our case, our second model has a more complex soil profile framework, but it better simulates soil water movement in the field and updates our understanding of how quickly water leaves the rooting zone.”

Snarski is now looking at what other factors influence these dynamic processes.

“After controlling for soil type, landscape position, and climate conditions, we are looking at whether soil management in different crop fields effects the water ages through the soil profile,” says Snarski. “If we see similar water ages across the various crop fields, crop type and soil management practices likely have a small effect on soil water movement. If we see large differences in the soil water ages, we will need to consider incorporating these factors into future models.”

Gift cards are one of the most popular presents to give during the holidays, but many people don’t get the best bang for their buck.

Last year, 43% of Americans reported having unused gift cards, according to consumer financial site Bankrate. That’s around $240 per person on average of unused money.

Here are five ways to get the most value out of your gift cards — even if it’s a gift card you don’t want.

1. Keep track of your card

It sounds simple, but a lot of people lose their gift cards or just forget about them before they ever get a chance to spend the money.

Budgeting expert Andrea Woroch suggests keeping your cards in a place where they’re always visible.

“I like to keep my gift cards in front of my credit card so I don’t forget to use them,” Woroch said. “You could also write a list of all the different gift cards you have.”

She also recommends keeping track of the balances. You can write it on a sticky note and attach it to the card, or create a digital spreadsheet.

If you’re trying to check your card’s balance, only use the website listed on the back of the card. Scammers like to impersonate gift card balance checking sites so always be cautious where you enter your card information online.

2. Combine with sales, promotions

Most retailers let you stack gift cards with other discounts so look for opportunities to maximize your savings, according to Woroch.

“After the holidays is actually a good time to use your gift card, as long as you’re using it on something you actually need, and not just spending to spend it,” she said. “Look for those sales; there’s going to be a lot of holiday clearances, especially on winter apparel, winter boots.”

You can also earn rewards on gift card dollars spent. Woroch personally recommends Fetch Shop, which is a free browser extension.

“With Fetch Shop you’ll earn points for all your online purchases regardless with how you pay, even if you’re paying with your gift card,” she said.

Once you amass enough points Woroch says you can use them to redeem more gift cards.

3. Sell or trade unwanted cards

If you received a gift card to a store you don’t shop at or restaurant you don’t like, you’re not out of luck.

Several legitimate websites like Gift Card Granny, Card Cash, and Raise let you sell your unwanted gift cards for cash or trade them for other cards.

“There’s a variety of these gift card resale sites that will pay you up to 92% of the value,” Woroch said. “Although you might not be getting the full amount in cash, it could be a much better deal than just getting a gift card that you don’t need and letting it go to waste, or buying something you really didn’t want.”

4. Redeem for cash

Did you know you can redeem unused gift card funds for cash in some states?

New Jersey is the only state in our area that lets you turn your gift card balances into a refund, but there’s a catch.

According to state law, only a gift card worth less than $5 is redeemable in cash. Still, that could add up if you have multiple cards with small remaining balances.

5. Don’t wait too long to use it

While it’s unnecessary to rush out and spend a gift card right away, you don’t want to wait too long because that business might not be there forever.

For example, local brewery Iron Hill recently file for bankruptcy making any unspent gift cards worthless.

Federal law requires gift cards to remain valid for at least five years after activation, but if the store or restaurant goes out of business before then there’s no guarantee you’ll get your money back.

Looking for help with a consumer issue? Click here to submit your complaint to In Your Corner.

You don’t need to be an oracle to know that the coming year will see further advances in artificial intelligence, as updated and new models, publications and patents continue their inexorable rise. If current trends are a reliable guide, many countries will also be enacting more AI-related laws and regulations. In 2023, at least 30 such laws were passed around the world, according to the Artificial Intelligence Index Report 2025, produced by researchers at Stanford University in California. The following year saw another 40.

Over the past couple of years, AI lawmaking has been busiest in the East Asia and Pacific region, in Europe and in individual US states. Between them, US states passed 82 AI-related bills in 2024. But there are some notable cold spots, too: there has been relatively little activity in low and lower-middle-income countries (see ‘AI policy trends’). Meanwhile, the US federal government is bucking the trend by cancelling AI policy work and challenging state-level AI laws.

This must be the year that more lower-income countries start regulating AI technologies, and that the United States is persuaded of the dangers of its approach. The country is one of the biggest markets for AI technologies, and people around the world are using models developed mainly by US companies. All nations need AI laws and policies, regardless of their position on the spectrum of producers and consumers. It’s impossible to imagine the technologies used in energy, food production, pharmaceuticals or communications being outside the ambit of safety regulation. The same should be true of AI.

There is a growing international consensus. The authorities in China, for example, are taking AI regulation extremely seriously, as are those of many European countries. Most of the rules of the European Union’s AI Act are expected to come into force in August. In 2024, the African Union published continent-wide guidance for AI policymaking. There are also moves to establish a global organization for cooperation on AI, possibly through the United Nations.

A wide spectrum of national and regional laws and regulations are in place or under development. Some countries, for example, are looking to ban ‘deepfake’ videos. This should be a universal goal. Companies should also provide details of the data used to train models, and need to ensure that copyright is respected in the training process. The overriding ambition must be to achieve regulations similar to those governing other general-purpose technologies. AI developers — most of which are companies (see ‘Model industry’) — need to transparently explain how their products work, demonstrate that their models have been produced through legal means, and show that the technology is safe and that there is accountability for risks and harm. Transparency is also needed from researchers, more of whom need to publish their models in the peer-reviewed literature.

According to UNCTAD, the UN trade-policy agency for low- and middle-income countries, two-thirds of high-income countries and 30% of middle-income countries had AI policies or strategies in place at the end of 2023, but little more than 10% of the lowest-income countries did. These nations need to be supported in their AI-regulatory efforts.

There is also a need to engage with the United States. On taking office, President Donald Trump cancelled a programme set up by the previous administration through which the National Institute of Standards and Technology had started to scope out AI standards with technology companies. In December, an executive order was issued forbidding state laws that conflict with White House AI policy.

The leaders of some technology companies seem to be satisfied with this direction of travel. But others know that good regulations give companies consistency in standards and allow them to plan predictably for the long term. Light-touch regulation, or no regulation at all, is in neither their nor their customers’ interests.

Civil servants working at regulatory agencies know that better regulation is needed, both to protect people, particularly children, from harm and to reassure consumers. They can see that there is considerable public anxiety about the risks of AI, fuelled, in part, by companies’ stated ambition to work towards artificial general intelligence. And they can hear the voices of those in the AI research community, including some of the field’s pioneers, who are warning of possible existential risks from uncontrollable AI.

Officials in the Trump administration have said that regulation will risk the United States losing the AI race with China. But, as Nature’s news team has reported (Nature 648, 503–505; 2025), China is exploring an alternative path to innovation. Its AI companies are creating innovative products, using technologies that are more open than those of US counterparts, and working to nationwide regulations that require more disclosure.

Technology companies know that their business models rely on public cooperation, particularly when it comes to access to data. That cooperation will evaporate if people lose confidence that their data are safe and being used responsibly, or learn that AI products are harming people.

AI is potentially a transformative technology. However, we don’t know how that will manifest, or what impact it will have. Many countries are rightly being cautious and assessing risks, but more coherence is needed in policymaking. Nations should work together to design policies that not only enable development, but also incorporate guardrails. Let 2026 be the year everyone agrees on that.

This article first appeared on GuruFocus.

Market participants are positioning for further potential upside in iron ore prices as a year-end rally across metals gathers momentum and attention turns to policy signals from Beijing. Iron ore futures have advanced for three consecutive sessions in Singapore, climbing nearly 1.8% intraday to as much as $106.55 a ton, putting prices on track for their highest close since late November. In China, contracts on the Dalian Commodity Exchange rose for a second day, gaining as much as 2.6%, the largest intraday increase since Sept. 9. The move has unfolded alongside strength across the metals complex, with copper reaching an all-time high and silver pushing past $80 an ounce, reinforcing a constructive backdrop into the end of the year.

Sentiment has also been supported by fresh policy guidance from Chinese authorities. The National Development and Reform Commission said it would deepen supply-side reforms in steel, petrochemicals and related sectors as part of the 15th Five-Year Plan from 2026, including expanding high-end production, prohibiting unauthorized capacity additions, and using market mechanisms to encourage consolidation. In parallel, the Ministry of Finance said after a year-end policy meeting that China will expand government spending and improve how it deploys capital in 2026. Taken together, these signals are being interpreted by markets as potentially supportive for resource-based industries, even though the details remain medium-term in nature.

That optimism has emerged despite softer near-term fundamentals. Iron ore inventories at Chinese ports rose for a 10th time in 11 weeks to the highest level in more than a year, according to Shanghai SteelHome E-Commerce, underscoring that the latest price move is being driven more by futures sentiment than by a clear recovery in physical demand. Prices have nevertheless shown resilience in recent months, helped in part by restrictions on some supplies from BHP Group (NYSE:BHP) imposed by China’s state-backed iron ore trader, even as steel demand in China has softened. By mid-afternoon in Singapore, iron ore futures were up 1.4% at $106.15 a ton, with yuan-priced contracts in Dalian and steel contracts in Shanghai also posting gains.

HOUSTON and LONDON, Dec. 29, 2025 (GLOBE NEWSWIRE) — Baker Hughes (NASDAQ: BKR) will announce the results of the fourth quarter and full year ending Dec. 31, 2025, via press release at 5 p.m. Eastern Time (4 p.m. Central Time) on Sunday, Jan. 25, 2026. A webcast to discuss the results will be held Monday, Jan. 26, at 9:30 a.m. Eastern Time (8:30 a.m. Central Time).

To access the webcast, listeners should visit the Baker Hughes website at: investors.bakerhughes.com. An archived version will be available on the website following the webcast.

About Baker Hughes
Baker Hughes (NASDAQ: BKR) is an energy technology company that provides solutions to energy and industrial customers worldwide. Built on a century of experience and conducting business in over 120 countries, our innovative technologies and services are taking energy forward – making it safer, cleaner and more efficient for people and the planet. Visit us at bakerhughes.com.

For more information, please contact:

Investor RelationsChase Mulvehill+1 346-297-2561
investor.relations@bakerhughes.com

Media RelationsAdrienne M. Lynch+1 713-906-8407
media.relations@bakerhughes.com

Source: Baker Hughes

Study participants and biological sampling

Patients were consecutively recruited at King’s College Hospital after admission to the ward or from the hepatology outpatient clinic. The study was granted ethics approval by the national research ethics committee (12/LO/1417) and local research and development department (KCH12-126) and performed conforming to the Declaration of Helsinki. Patient participants, or their family nominee as consultees in the case of lack of capacity, provided written informed consent within 48 h of presentation. Patients were managed according to standard evidence-based protocols and guidelines⁷⁴. Patient and public involvement and engagement were undertaken with a patient advisory group that partnered with us to determine acceptability of the study; provided their perspective on study design, informational material and measures to minimize participation burden; and agreed on a dissemination plan of the findings.

Patient participants were stratified into and phenotyped according to clinically relevant groups based on the severity and time course of their underlying cirrhosis, degree of stability and hepatic decompensation, and presence and extent of hepatic and extrahepatic organ failure at the time of sampling. These groups were cACLD, AD and ACLF, with separately recruited healthy controls (Ctrl:HC) and patients with sepsis with no underlying ACLD as an additional control group (Ctrl:Septic). AD was defined as acute development of one or more major complications of cirrhosis, including ascites, hepatic encephalopathy, variceal haemorrhage and bacterial infection. ACLF was defined and graded according to the number of organ failures in concordance with criteria reported in the CANONIC study^75,76. Main exclusion criteria included pregnancy, hepatic or non-hepatic malignancy, pre-existing immunosuppressive states, replicating HBV, HCV or HIV infection, and known IBD.

Demographic, clinical and biochemical metadata were collected at the time of biological sampling. Standard clinical composite scores used for risk stratification and prognostication included the Child–Pugh score⁷⁷ and MELD⁷⁸. For patients with sepsis without chronic liver disease (Ctrl:Septic), the diagnosis of sepsis was based on the Sepsis-3 criteria⁷⁹ in which life-threatening organ dysfunction caused by a dysregulated host response to infection was evident, with organ dysfunction defined as an increase in the sequential (sepsis-related) organ failure assessment (SOFA) score of 2 points or more. The absence of chronic liver disease in this patient group was determined by a combined assessment of clinical history and biochemical and radiological parameters.

Healthy controls aged >18 years (n = 52) were recruited to establish reference values for the various assays performed. Exclusion criteria for healthy controls were body mass index <18 or >27; pregnancy or actively breastfeeding; personal history of thrombotic or liver disease; chronic medical conditions requiring regular primary or secondary care review and/or prescribed pharmacotherapies; or current use of anticoagulants, platelet function inhibitors or oral contraceptives.

Plasma FABP2 quantification

Plasma samples for FABP2 profiling and quantification were obtained within 24 h of admission to hospital. Intestinal FABP2 (refs. ^42,44) was quantified to serve as a gut-specific marker of intestinal barrier integrity, to assess whether these differentiated at the different stages of cirrhosis and in the Ctrl:HC cohort to define whether physiological or basal levels were detectable. FABP2 was quantified using the human FABP2/I-FABP Quantikine enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems). All assays were conducted according to the manufacturers’ instructions. Optical densities were measured with a FLUOstar Omega absorbance microplate reader.

Faecal and saliva sample acquisition

Faecal samples were obtained within 48 h of admission to hospital and collected into non-treated sterile universal tubes (Alpha Laboratories) without any additives. Faecal samples were kept at 4 °C without any preservative and were homogenized within 2 h and pre-weighed into 200-mg aliquots in Fastprep tubes (MP Biomedicals). Saliva samples were obtained within 48 h of admission and collected into non-treated sterile universal tubes (Alpha Laboratories) without any additives. A controlled passive ‘drool’ was performed by the study participant into a universal container repeatedly until at least 6 ml of saliva was obtained. For patients who were intubated for mechanical ventilation, oropharyngeal suctioning of accumulating oral secretions was performed. Saliva samples were kept at 4 °C without any preservative and within 2 h were homogenized and measured into 1-ml aliquots using sterile wide-bore pipettes in Fastprep tubes (MP Biomedicals), which were then centrifuged at 17,000 g for 10 min. The saliva supernatant was removed and stored separately from the remaining pellet. Faecal and saliva samples were stored at −80 °C for subsequent DNA extraction and metabolite measurements.

Metagenomic data generation for saliva and faecal samples

Metagenomic data of SRA Project ID PRJEB52891 were generated as part of a previous study⁸⁰. Briefly, microbial DNA was extracted from stored faecal and saliva pelleted samples using a 2-day protocol adapted from the International Human Microbiome Standards^81,82. A 200-mg pre-weighed and homogenized aliquot was used for faeces, while for saliva, a post-centrifugation pellet was used. For the processing of additional healthy control samples (project ID: PRJNA1307628), sample collection and storage were identical to those of the initial cohort samples. DNA for the additional faecal samples was extracted with the AllPrep PowerFecal DNA/RNA Kit Qiagen (kit catalogue number 80244), and for saliva samples, the extraction kit DNeasy PowerSoil Pro Kit (Qiagen, 47014) was used according to the manufacturer’s instructions. DNA was subsequently sequenced (Illumina NovoSeq, paired-end mode, read length 2 × 150 bp) with a targeted sequencing depth of 25 Gbp for both saliva and faecal samples. Reads retained after quality control were uploaded to the Sequence Read Archive (SRA).

Quantification of absolute bacterial abundances using qPCR

To quantify total bacterial biomass and V. parvula absolute abundances, we performed qPCR assays following the protocol of previous studies^35,83. Briefly, we first conducted serial dilutions of E. coli (strain BL21(DE3)) culture grown in Gifu Anaerobic Broth, modified agar (mGAM) medium and enumerated colony-forming units (CFU) for each of the dilutions. Next, DNA isolation was performed using 6 ml of E. coli culture applying phenol-chloroform-isoamylalcohol as described in a previous study⁸⁴. A universal 16S rRNA primer⁸³ targeting the V9 region (forward: AGAGTTTGATYMTGGCTCAG; reverse: TACGGYTACCTTGTTACG ACT) was used, and 2 μl of DNA was added to the mix of 2 μl of nuclease-free water, 0.5 μl of forward and reverse primers (10 μM) and 5 μl of 2 × SensiFast SYBR mix (BioCat). The assay was run according to the following set-up: initial denaturation for 2 min at 95 °C, 40 cycles of 3-step cycling at 95 °C for 15 s, 53 °C for 15 s and 72 °C for 15 s followed by melting at 95 °C for 30 s, 53 °C for 30 s and 60 °C for 1 s with final cooling at 40 °C for 30 s. The same procedure was repeated for the V. parvula patient isolate with nifJ gene-specific primers introduced in a previous study³⁵ (forward: TGGTGACCACCAAGACGTAA; reverse: ACAGCATCCATGTCAACCAA). Based on the computed crossing point (Cp) values, calibration curves were established as described in a previous study⁸⁵ to set ratios between cycle threshold (Ct) values and calculated CFUs further enabling estimations of CFU per gram faeces (Extended Data Fig. 2d,e). Next, patient samples were processed using the same qPCR set-up and master mix with both V9 region 16S and V. parvula-specific nifJ primers and compared with the calibration curve.

Metagenomic data analysis

The metaGEAR pipeline was used for metagenomic quality control, reference-based microbial profiling and gene-centric analyses (https://github.com/schirmer-lab/metagear-pipeline). Briefly, raw metagenomic reads went through the following quality control pipeline to remove (1) sequencing adaptors, (2) low-quality reads and (3) human host contaminations. First, we applied trim_galore⁸⁶ for adaptor removal using the parameters ‘–paired –phred33 –quality 0 –stringency 5 –length 10’. Then, we applied KneadData (https://github.com/biobakery/kneaddata) to remove low-quality reads and host contaminations. Low-quality reads and adaptors were removed using the parameters ‘–trimmomatic-options ‘SLIDINGWINDOW:4:15 MINLEN:50’’. Human reads were removed by mapping against the human reference genome (hg38). In addition, tandem repeats were removed using the default ‘trf’ option. The ‘–reorder’ flag was applied to match quality-controlled forward and reverse reads.

For reference-based microbial profiling and strain comparison, we first applied MetaPhlAn3 (ref. ³⁷) to profile the microbial community based on clade-specific marker genes. Strain-level profiles were then generated for the species of interest based on (1) SNPs in the marker genes using StrainPhlAn3 (ref. ³⁷) and (2) presence–absence profiling of gene families using PanPhlAn3 (ref. ³⁷).

Assembly-based analyses for generating metagenomic assembled pangenomes included de novo assembly using MEGAHIT with default parameters⁸⁷ for each sample. Then, protein-coding genes were predicted using Prodigal with the ‘-p meta’ flag^88,89. Incomplete genes were subsequently filtered with the ‘partial==00’ flag. Afterwards, genes from different samples were merged and clustered to generate a gene catalogue using cd-hit-est⁹⁰ with parameters ‘-aS 0.9 -aL 0.9 -c 0.95’ to group genes with sequence identity >95% and coverage >90%. Protein sequences were extracted for the representative sequences of each gene family and further grouped into a protein catalogue using cd-hit^90,91 with parameters ‘-c 0.9 -aL 0.8 -aS 0.8’ to group proteins with sequence identity >90% and coverage >80%. Abundance profiles for the clustered genes were generated using CoverM⁹² contig (methods count and reads per kilobase per million mapped reads (RPKM)) using parameters ‘–min-read-percent-identity 95 –min-read-aligned-percent 75 –min-covered-fraction 20’.

The protein catalogue was annotated with interproscan v5.47-82.0 (refs. ^93,94) using the parameter ‘-appl Pfam’ to get domain-level annotation. Functional group annotation was extracted for each representative sequence of the protein families by combining Pfam domain annotations according to their order for each protein. Afterwards, reads from each sample were mapped against the gene catalogue to obtain the respective abundance profiles. The MSPs were generated with MSPminer⁹⁵ with its default parameters. Taxonomy annotation for each MSP was predicted based on gtdb-tk (v2.3.0)⁹⁶ on its pangenomes, and the abundance of each MSP was profiled by the median abundance of its core genes in each sample.

Integration of reference- and assembly-based results

Many MSPs lacked species-level taxonomy annotations based on gtdb-tk annotations. Therefore, we introduced a new taxonomy annotation approach for MSPs that additionally integrates information from reference-based profiles. This approach is based on the assumption that each MSP will have a similar abundance profile as its corresponding referenced-based counterpart. Therefore, we inferred MSP taxonomic information based on abundance correlations with reference-based abundance profiles (MetaPhlAn3). For each MSP, the species from the MetaPhlAn profile with the best abundance correlation was assigned as its taxonomic annotation.

Definition of dysbiosis score

We adapted the dysbiosis score introduced by a previous study³⁴ to quantify the deviation of a given patient sample from the healthy control group. For our study, we calculated the dysbiosis separately for faecal and saliva samples. Specifically, for each body site, the dysbiosis score D for sample x is defined as the median Bray–Curtis distance to the samples from the healthy control group:

Identification of candidate oral–gut translocators

First, we identified co-occurring species within each sample pair. For this, species were required to be present with a relative abundance of >0.1% in both sample types. Species were defined as candidate oral–gut translocators if they (1) frequently co-occurred in paired faecal and saliva samples (detected in at least five paired samples) and (2) were common members of the healthy oral microbiome (>1% abundance and detected in >20% of saliva samples). Overall, the number of co-occurring species was 26 (details in Supplementary Table 1). Among these, nine species were commonly detected in the oral samples, forming the final list of our candidate oral–gut translocators for the subsequent analyses. For each candidate translocator, we then compared the strain-level similarity between paired and unpaired samples using two different strategies: Phylogenetic similarity was quantified with the Kimura 2-parameter (K2P) genetic distance based on marker gene alignment generated with StrainPhlAn3 (ref. ³⁷). The function distmat (https://www.bioinformatics.nl/cgi-bin/emboss/help/distmat) was used, which calculates the evolutionary distance between every pair of sequences in a multiple sequence alignment. Distances are expressed in terms of the number of substitutions per 100 bases. In addition, gene content similarity was compared, which was measured by the binary distance between the gene content of strains inferred with PanPhlAn3 (ref. ³⁷).

Associations of bacterial species with disease severity and plasma barrier dysfunction

The faecal abundance of oral–gut translocators was analysed for associations with clinical indices, including disease severity (Child–Pugh and MELD scores) and barrier dysfunction (plasma FABP2). We used the pcor.test function in R to calculate partial correlations and corresponding P values between each species and each clinical index. Associations were computed using a rank-based Spearman method, with age, gender and antibiotic usage included as covariates. P values were calculated using asymptotic t approximation (with default options in the pcor.test function). The detection limit for MetaPhlAn was set at 0.01%, with abundances below this threshold set to zero. BH-adjusted P values were calculated separately for each clinical index, and results were visualized as a heatmap in which colours indicate partial correlation and asterisks denote significance levels (***P < 0.01; **P = 0.01–0.05; *P = 0.05–0.2).

Statistics and reproducibility

This is a non-interventional, cross-sectional, prospective cohort study. No predefined sample size was determined, and no data were excluded from the analyses. Our sample sizes are comparable to those reported in previous publications^26,80,97. Data collection and analysis were not performed blind to the conditions of the experiments.

Statistical analyses involving the five disease subgroups

For these analyses, the healthy control group, Ctrl:HC, was compared with each of the disease subgroups, including cACLD, AD, ACLF and Ctrl:Septic. In addition, the cACLD group was compared with AD and ACLF to evaluate differences involved in disease progression. This resulted in six statistical tests in total. All P values were correct for multiple testing (BH), and adjusted P values were reported (Figs. 1b,c, 2c and 3d and Extended Data Fig. 1a). For a subset of supplementary figures, the primary focus was on identifying changes between healthy controls (Ctrl:HC) and disease subgroups; here only four statistical comparisons were performed and corrected for multiple testing (Extended Data Figs. 1b, 2b, 3a and 4a).

Associations between oral–gut translocators and clinical indices

To test for associations between the nine species identified as potential oral–gut translocators with Child–Pugh, MELD scores and plasma FABP2 levels, respectively, nine statistical tests were performed for each index. All P values were corrected for multiple testing (BH) and adjusted P values are reported (Extended Data Figs. 2a and 3a).

All P values mentioned above are calculated using two-side Wilcoxon tests.

Strain isolation

Saliva and faecal strains were isolated on SK agar plates (as used in previous work⁹⁸) supplemented with vancomycin (Vc; 7.5 μg μl⁻¹), chloramphenicol (Cm; 0.5 μg μl⁻¹) and erythromycin (Ery; 14.6 μg μl⁻¹), in addition to mGAM agar plates (HiMedia M2079). SK (Vc, Cm and Ery) and mGAM agar plates (1.5% agar, Fisher Scientific, 10572775) were prepared. For plates supplemented with Vc, Cm and Ery, antibiotics were added during the plate preparation. All plates were transferred to an anaerobic chamber under anaerobic conditions (5% H₂, 10% CO₂ and 85% N₂) to be pre-reduced for 24 h before plating. Frozen saliva and faecal samples were thawed in the anaerobic chamber and serial dilution was realized, in which 100 μl of diluted samples was dispensed and spread on the plates. The plates were incubated for up to 4 days at 37 °C in the anaerobic chamber for colony growth.

After each day, strain imaging and colony picking were performed for further isolation. The colony picking was based on the identification of morphologically unique colonies including area perimeter, circularity, convexity, colour and consistency. Colonies were stricken on the equivalent media from which they were picked and incubated at 37 °C in the anaerobic chamber for colony growth.

Bacterial strains and growth conditions

Supplementary Table 1 lists the bacterial strains used in this study. Strains were grown at 37 °C in an anaerobic chamber (Whitley M45, Meintrup DWS Laborgeräte) at an atmosphere of 5% H₂, 5% CO₂ and 90% N₂. MS082 was cultivated on mGAM (Himedia) agar plates. Strains MS055, MS061, MS072, MS097, MS107 and MS164 were cultivated in SK broth or on agar plates (Difco tryptone 10 g l⁻¹, yeast extract 10 g l⁻¹, NaCl 2 g l⁻¹, Na₂HPO₄ 0.4 g l⁻¹)³⁵.

Growth curve characteristics of Veillonella strains

Strains MS055 and MS061 were grown in SK broth as detailed under the ‘Bacterial strains and growth conditions’ section, and in SK medium supplemented with 50 mM DL-lactate (Sigma-Aldrich) or 50 mM potassium nitrate (Sigma-Aldrich), respectively. In brief, overnight cultures of MS055 and MS061 in SK medium were diluted into fresh medium for log-phase growth and used to inoculate the main culture of 6 ml medium (start optical density at 600 nm (OD₆₀₀) 0.05) of SK medium only, and SK medium with 50 mM lactate or nitrate, respectively. Growth of strains was monitored every 2 h using a spectrophotometer (CO8000, Biowave). The results represent three independent experiments and are presented as means with standard errors of the means.

Gene neighbourhood visualization from de novo assemblies

For each gene family of interest, we retrieved all assembled contigs containing this gene. Then, we aligned the contigs centred to the gene of interest taking strand information into account. The gene families in the same relative position to the centre gene were retrieved, and the most prevalent gene family at each relative position was visualized including the number of observations of that gene.

Identification of prtC homologues in MSPs

Each candidate oral–gut translocator species was first matched to their corresponding MSPs based on gtdb-tk taxonomic annotations of the assembled MSPs and linear correlations of the respective MetaPhlAn and MSP abundances (for further details, see section ‘Integration of reference- and assembly-based results’). We were able to assign MSPs for seven out of nine oral–gut translocators. FG annotations for each gene family in the MSPs were extracted, and 288 FGs were found to be commonly shared among MSPs associated with oral–gut translocation (>80% prevalence). Next, we excluded functional groups that represent functions commonly found in the gut, by comparing these 288 FGs to those present in the core genomes of prevalent gut commensals. For this comparison, we selected MSPs with a mean abundance greater than 5% across all healthy faecal samples, including P. copri, B. uniformis and F. prausnitzii. FGs were filtered if they were also present in these common healthy gut microorganisms, and this filtering step reduced the number of remaining FGs to 52, which may represent bacterial functions that are essential for oral–gut translocation and/or result in aberrant host–microbial interactions in disease. Cumulative faecal abundances for these 52 FGs were calculated by summing over all matched gene families in oral–gut translocators. Subsequently, we further prioritized these FGs according to the correlations between their faecal abundance and plasma FABP2 levels. For this, the pcor.test function in R (rank-based Spearman) was used to calculate partial correlations with age, gender and antibiotic usage included as covariates. P values were corrected for multiple testing with BH.

Predicting ACLD based on faecal prtC gene abundance

First, the cumulative abundance of prtC genes encoded by oral–gut translocators was inferred for each faecal sample and represented as a single value with the detection limit set to 0.5 RPKM. These values were then used to predict disease status: any sample with a value above this threshold was predicted as ‘ACLD’, and samples below this value as ‘control’. The confusion matrix, specificity and sensitivity are reported in Supplementary Table 2. The corresponding receiver operating characteristic (ROC) and precision–recall (PR) curves were generated using the cumulative prtC abundance as the predictor and actual disease status (based on the clinical metadata) as the ground truth (1 for ACLD, 0 for controls)

Verification of the prtC signals in CLD-Sole2021 cohort

The cohort of a previous study¹¹ (CLD-Sole2021) contained metagenomic data with single-end reads based on ion proton sequencing. Due to the shorter read length and lower read quality, we did not assemble this dataset but used a mapping-based strategy (bowtie2) against the gene catalogue generated from our cohort. RPKM values are calculated from reads mapped to the prtC genes.

Structure comparisons between prtC genes and a known bacterial collagenase

We applied blastx to search the UniProt database using gene sequences of the prtC genes identified in our cohort (Supplementary Table 2). The best hit for each query sequence was taken for further analysis, in which the predicted protein structure was downloaded as .pdb format and was aligned against the structure of a well-characterized bacterial collagenase (P33437). In cases in which multiple queries matched the same protein from the UniProt database, we took only one matched protein for downstream analysis. For example, the prtC genes from V. parvula, V. atypica and V. dispar were all mapped to Veillonella sp. HPA0037; therefore, we used the predicted prtC structure from Veillonella sp. HPA0037 for the alignment to represent these three prtC genes. To quantify the structural similarity, the RMSD was calculated for each structure alignment.

Experimental procedures in animals

In vivo experimental procedures were performed in 10–12-week-old male C57/Bl6 mice at the Disease Modelling Unit (University of East Anglia, UK). Experiments were approved by the Animal Welfare and Ethical Review Body (University of East Anglia, Norwich, UK) and the UK Home Office (project licence to Beraza: PP9417531, protocol 6). All procedures were carried out following the guidelines of the National Academy of Sciences (National Institutes of Health, publication 86-23, revised 1985) and were performed within the provisions of the Animals (Scientific Procedures) Act 1986. All animals were provided with free access to food (EURodent Diet 22%) and water. The animals were randomly assigned to cages and to the various experimental groups. No animals or data were excluded.

Induction of hepatic fibrosis in vivo

Mice were treated with CCl₄ (1 ml kg⁻¹) that was administered intraperitoneally (IP) twice per week for a total of 6 weeks. One group of mice received 200 μl of a bacterial cocktail (10⁹ CFU ml⁻¹) composed of V. parvula (isolates MS061, MS107 and MS164), V. dispar (isolate MS072) and S. parasanguinis (isolate MS082) by oral gavage 2 weeks after the initiation of CCl₄ treatment. The strain cocktail was administered for three consecutive days each week for 4 weeks (week 3 to week 6 of treatment). All mice were killed 2 days after the last administration of CCl₄ (Fig. 4a).

Quantification of fibrosis severity in mice

Liver tissues were fixed in 10% neutral buffered formalin (Sigma–HT501128-4L), embedded in paraffin and sectioned. Liver sections were dewaxed, hydrated and stained with Sirius red to stain collagen and detect fibrosis. Slides were imaged on a BX53 upright microscope (Olympus) with an Olympus DP74 colour camera and a pT100 LED transmitted light source (CoolLED). For quantification of the deposition of collagen in the liver, a total of 6–10 fields of view per sample were imaged and analysed using open-source FIJI software⁹⁹. Images were split into three channels using the Colour tool, and the green channel was selected for quantification. A consistent threshold was applied across all images. Fibrosis was represented as the percentage of stained area relative to the total area per field¹⁰⁰.

Quantification of gut barrier dysfunction in mice

Frozen faecal material from the large intestine was weighed and diluted in a 1:15 weight-to-volume ratio using extraction buffer (50 mM Tris HCl, 150 mM NaCl, 0.1% SDS, 2 mM EDTA (pH 8.0)). Samples were homogenized 3 times at 6 m s⁻¹ for 40 s, and homogenates were centrifuged at 13,523 g (12,000 rpm) at 4 °C for 10 min. Supernatants were collected and assessed for albumin levels. Albumin levels were quantified using the DY1455 human albumin Duoset ELISA from R&D Systems according to the manufacturer’s instructions. Results were quantified using a FluoStar Optima plate reader. The mouse gastro-intestinal tract was dissected into anatomically defined regions, and the terminal portions of the ileum and colon were fixed and embedded in paraffin for immunohistological analysis: slides were mounted with a 4′,6-diamidino-2-phenylindole (DAPI)-mounting solution (Vector Laboratories H-1200) to stain cell nuclei. Fluorescence microscopic imaging was performed using an AxioImager M2 (Zeiss) with the AxioCam mRM monochrome camera and standard light source and filter sets supplied.

Preparation of faecal water

Frozen faecal samples from patients with AD (n = 10) and healthy individuals (n = 10) were thawed on ice. A 0.3-g aliquot from each sample was suspended in 2 ml of 1× phosphate-buffered saline and homogenized thoroughly. The homogenates were centrifuged at 5,000 g for 30 min at 4 °C. The resulting supernatants were collected and subjected to two additional centrifugation steps at 5,000 g for 20 min and 10 min, respectively, both at 4 °C. Supernatants were collected and kept on ice after each step for downstream analysis.

E. coli BL21(DE3) pET29b(+)/prtC transformation

The prtC gene sequence from V. parvula (isolate MS055) was synthetized and cloned in pEt29b(+) by TwistBioscience. Competent E. coli BL21 was transformed by heat shock with the pET-29b(+)/prtC vector and plated on Luria broth agar media supplemented with kanamycin (25 μg ml⁻¹) and incubated for 24 h at 37 °C.

Recombinant protein expression and preparation

E. coli BL21(DE3) and BL21(DE3) harbouring the pET-29b(+)/prtC plasmid were cultured in 100 ml Luria broth at 25 °C until reaching an optical density (OD₆₀₀) of 0.8. Protein expression in BL21(DE3) pET-29b(+)/prtC was induced with 0.1 M isopropyl β-D-1-thiogalactopyranoside (IPTG), followed by incubation at 25 °C for 18 h. Induced and non-induced cultures were centrifuged at 5,000 g for 20 min at 4 °C. The resulting supernatants were transferred to Amicon Ultra Centrifugal Filter tubes and centrifuged again at 5,000 g for 10 min at 4 °C.

Collagenase activity in faecal water: collagen degradation assay

Collagen degradation was assessed using the EnzChek Gelatinase/Collagenase Assay Kit (Thermo Fisher Scientific). DQ-collagen I was added to concentrated supernatants or faecal water, a media-only control and a positive control (Clostridium histolyticum’s collagenase) at a final concentration of 100 µg ml⁻¹. Samples were incubated overnight at 37 °C. Fluorescence was measured at an excitation wavelength of 495 nm and emission at 515 nm. The fluorescence intensity was directly proportional to the extent of collagen degradation.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.