New design could make augmented reality glasses more power-efficient and practical for everyday wear.
Researchers at the University of Rochester have designed and demonstrated a new optical component that could significantly enhance the brightness and image quality of augmented reality (AR) glasses. The advance brings AR glasses a step closer to becoming as commonplace and useful as today’s smartphones.
“Many of today’s AR headsets are bulky and have a short battery life with displays that are dim and hard to see, especially outdoors,” says research team leader Nickolas Vamivakas, the Marie C. Wilson and Joseph C. Wilson Professor of Optical Physics with URochester’s Institute of Optics. “By creating a much more efficient input port for the display, our work could help make AR glasses much brighter and more power-efficient, moving them from being a niche gadget to something as light and comfortable as a regular pair of eyeglasses.”
In the journal Optical Materials Express, the researchers describe how they replaced a single waveguide in-coupler—the input port where the image enters the glass—with one featuring three specialized zones, each made of a metasurface material, to achieve improved performance.
“We report the first experimental proof that this complex, multi-zone design works in the real world,” says Vamivakas. “While our focus is on AR, this high-efficiency, angle-selective light coupling technology could also be used in other compact optical systems, such as head-up displays for automotive or aerospace applications or in advanced optical sensors.”
Metasurface-powered AR
In augmented reality glasses, the waveguide in-coupler injects images from a micro-display into the lenses so that virtual content appears overlaid with the real world. However, the in-couplers used in today’s AR glasses tend to reduce image brightness and clarity.
To overcome these problems, the researchers used metasurface technology to create an in-coupler with three specialized zones. Metasurfaces are ultra-thin materials patterned with features thousands of times smaller than a human hair, enabling them to bend, focus or filter light in ways conventional lenses cannot.
“Metasurfaces offer greater design and manufacturing flexibility than traditional optics,” says Vamivakas. “This work to improve the in-coupler, a primary source of light loss, is part of a larger project aimed at using metasurfaces to design the entire waveguide system, including the input port, output port and all the optics that guide the light in between.”
For the new in-coupler, the researchers designed metasurface patterns that efficiently catch incoming light and dramatically reduce how much light leaks back out. The metasurfaces also preserve the shape of the incoming light, which is essential for maintaining high image quality.
This research builds on earlier theoretical work by the investigators that showed a multi-zone in-coupler offered the best efficiency and image quality. Vamivakas says that advances in metasurface gratings enabled the design flexibility to create three precisely tailored zones while state-of-the-art fabrication methods—including electron-beam lithography and atomic layer deposition—provided the precision needed to build the complex, high-aspect-ratio nanostructures.
“This paper is the first to bridge the gap from that idealized theory to a practical, real-world component,” says Vamivakas. “We also developed an optimization process that accounts for realistic factors like material loss and non-ideal efficiency sums, which the theory alone did not.”
Three-zone performance test
To demonstrate the new in-coupler, the researchers fabricated and tested each of the three metasurface zones individually using a custom-built optical setup. They then tested the fully assembled three-zone device as a complete system using a similar setup to measure the total coupling efficiency across the entire horizontal field of view from -10 degrees to 10 degrees.
The measurements showed strong agreement with simulations across most of the field of view. The average measured efficiency across the field was 30 percent, which closely matched the simulated average of 31 percent. The one exception was at the very edge of the field of view, at -10 degrees, where the measured efficiency was 17 percent compared to the simulated 25.3 percent. The researchers attribute this to the design’s high angular sensitivity at that exact angle as well as potential minor fabrication imperfections.
The researchers are now working to apply the new metasurface design and optimization framework to other components of the waveguide to demonstrate a complete, high-efficiency metasurface-based system. Once this is accomplished, they plan to expand the design from a single color (green) to full-color (RGB) operation and then refine the design to improve fabrication tolerance and minimize the efficiency drop at the edge of the field of view.
The researchers point out that for this technology to be practical enough for commercialization, it will be necessary to demonstrate a fully integrated prototype that pairs the in-coupler with a real micro-display engine and an out-coupler. A robust, high-throughput manufacturing process must also be developed to replicate the complex nanostructures at a low cost.
Knee and epidural infiltrations are among the most common rheumatological procedures. Due to the shortage of rheumatologists in Cameroon (Sub-Saharan Africa), GPs play a vital role in treating patients with rheumatic diseases. However, before recommending this routine practice to GPs, it is necessary to assess their knowledge and practices, which was the aim of our study. There is little data available on this subject in sub-Saharan Africa, despite the recognized importance of GPs in the management of many rheumatic diseases [14]. Our study found that infiltration practices among GPs in Cameroon were performed in 23.2% of cases for the knee and 8.5% for the epidural. Knowledge and practice scores for these procedures are average and are linked to certain factors related to undergraduate and postgraduate training.
We found that GPs performed 23.2% of knee infiltrations and 8.5% of epidural infiltrations. The use of knee and epidural infiltrations by GPs varies according to geographical context. In high-income countries such as France, studies indicate that 15 to 30% of cases of knee osteoarthritis are managed with infiltrations by GPs, while epidurals predominantly remain the responsibility of specialists [15]. Key determinants include access to ultrasound guidance, which reduces failure rates for knee infiltrations, and ongoing training [15, 16]. Conversely, in sub-Saharan Africa, where rheumatologists are scarce, GPs perform these procedures more frequently despite the risks [17, 18]. This is also due to a lack of accessible therapeutic alternatives, such as surgery, competent physiotherapy, and the limited technical resources available [18]. Certain patient-related factors may also influence the use of infiltrations, notably obesity, as reported by Bello et al. [18].
We reported average scores for knowledge of knee and epidural infiltration, as well as for practice. There is a lack of literature on GPs’ knowledge of infiltration. This includes indications and absolute contraindications, such as active joint infection, anticoagulation and unbalanced diabetes, as well as the management of side effects, such as post-corticoid hypertensive flare-ups. A French study reported that only 40% of GPs were familiar with contraindications [15]. Factors influencing this poor level of knowledge and practice included gender; undergraduate rheumatology training of less than four weeks; having been in practice for less than three years; and never having attended a workshop or training course on infiltration. These data are consistent with literature. Liddell et al., in a study of 251 GPs in the United Kingdom, found that gender (male), experience (more than 10 years), specialized training (interest in rheumatology or orthopedics), and those practicing in rural areas were significant determinants of performing intra-articular injections, particularly in the knee, shoulder, and elbows [19]. In Germany, Spruit et al. found that 81% of GPs surveyed felt competent in performing musculoskeletal injections, particularly due to a lack of confidence in injection procedures, a lack of practical training, and little confidence in the diagnosis and therapeutic benefits of these procedures. They also reported a high referral rate after the procedure [20]. In a study of 204 GPs in Ireland, Farrell et al. found that 72% performed intra-articular injections, particularly in the knee and shoulder, with barriers such as their skills and medico-legal concerns [21]. Moore et al., in an interview with primary care physicians, found that barriers included a lack of confidence and discomfort with these procedures, the risk of side effects, incertitude regarding evidence and guidelines, and technical uncertainties [22].
Specialized training (e.g. workshops, echoguidance), access to contextualized recommendations, and clinical experience can significantly improve GPs’ knowledge and skills in rheumatology procedures [15, 16, 23]. Improving the training of GPs would likely reduce patient waiting times for these procedures and decrease the rate of referrals after the procedure [19]. Conversely, poor knowledge is associated with professional isolation, a lack of interaction with rheumatologists, and a scarcity of continuing training courses adapted to the local context, particularly in sub-Saharan Africa [17, 24]. It should also be noted that logistical constraints in Sub-Saharan Africa lead to non-standardized practices and higher rates of complications [18].
In order to improve the current situation in Cameroon, a number of important lessons need to be learned. With regard to training, we should advocate improving exposure to rheumatology during undergraduate internships and developing short training modules on rheumatology procedures (including punctures and infiltrations), as well as simplified protocols for GPs to use [25]. Telemedicine should be used to mentor young GPs, especially in rural areas [18]. Finally, reinforce practical teaching during undergraduate courses and encourage postgraduate training in rheumatology procedures.
Interpretation of the data from this study must take into account a number of limitations. Firstly, there is the common bias in data collection associated with online studies. Nevertheless, this is an important means of obtaining data for this type of study. Another limitation is the small sample size, as 80% of the 500 GPs trained annually in Cameroon leave the country, making them ineligible for the study. Additionally, this study focused on young GPs with no more than 5 years’ experience, due to the harmonization of undergraduate training programs in Cameroon 12 years ago, with the first cohort graduating 5 years ago. Nevertheless, this study enables us to establish the current situation and identify the key determinants on which it will be crucial to act. These data are consistent with those reported in the literature. Further studies are needed to assess teaching methods related to these procedures for undergraduate students and to evaluate the impact of workshops and courses on the current level of knowledge and practice of postgraduate GPs.
Subcellular localization of NnWOX1-1 and NnDREB2C transcription factors
The pCAMBIA1300 vector containing green fluorescent protein (GFP) was used as the overexpression vector, and GFP fusion expression was employed to identify “positive” transgenic plants. The full-length CDS of NnWOX1-1 and NnDREB2C were cloned, and then inserted into the pCAMBIA1300 vector. The positive plasmid was then transformed into Agrobacterium tumefaciens GV3101 (Weidi Biotechnology Co., Ltd., Shanghai, China). After verification by PCR method, bacterial cultures containing the target genes were obtained. Single colony was selected and cultured overnight to prepare the tobacco leaf infection solution. The pCAMBIA1300 vector carrying an empty plasmid was used as the control. The bacterial suspension containing the pCAMBIA1300 vector with the target gene was used to infect Nicotiana benthamiana leaves aging 35–45 days. Before infection, the tobacco plants were exposed to strong light for 10 min to promote stomatal opening. A 1 mL syringe was used to draw the infection solution, and the abaxial side of the tobacco leaves (avoiding the veins) was infiltrated. After 2–3 days of dark cultivation, the infiltrated epidermal tissue was sampled and examined under a super-resolution laser confocal microscope (LSM 880NLO, Carl Zeiss, Germany) to observe GFP fluorescence signals.
Vectors construction of NnWOX1-1 and NnDREB2C transcription factor
For the overexpression vector construction, the laboratory had previously successfully constructed the NnWOX1-1 overexpression vector and preliminarily validated the gene’s function in Arabidopsis [27]. For the NnDREB2C overexpression vector construction, the cloning vector harboring the target gene and the overexpression vector pCAMBIA1300 were subjected to double digestion with BamHI and XbaI.
restriction enzymes. Following digestion, DNA fragments of the desired size were excised from the agarose gel and purified using a commercial DNA gel extraction kit. The purified target fragment and the linearized vector backbone were ligated using T4 DNA ligase at 16 °C for cohesive-end assembly.
The ligation product was transformed into chemically competent E. coli (DH5α) cells, which were subsequently plated onto LB agar supplemented with 100 µg/mL ampicillin (1‰ Amp). After overnight incubation at 37 °C, single colony was inoculated into LB liquid medium containing ampicillin, and incubated with shaking (37 °C, 12 h). For confirmation of correct assembly, the recombinant plasmid was re-digested with BamHI/XbaI, and the restriction pattern was analyzed. Final validation was performed through full-length sequencing by Nanjing Qingke Biotechnology Co., Ltd.
For the RNAi vector construction of NnWOX1-1 and NnDREB2C, the RNAi interference fragment was derived from a partial nucleotide sequence spanning the coding region and the 3′ untranslated region (UTR). The forward primer sequences of NnWOX1-1 were: upstream, 5′-GGGGTACCAAGGAGACTGAGGTGCCGAA-3′; downstream, 5′-CGGGATCCATGTAAGCTTCACCCATTAA-3′. The reverse primer sequences were: upstream, 5′-GCGTCGACAAGGAGACTGAGGTGCCGAA-3′; downstream, 5′-GCTCTAGAATGTAAGCTTCACCCATTAA-3′. The forward primer sequences of NnDREB2C were: upstream, 5′- GGGGTACCGCCTTAGAGC.
TGCCGGAGTG − 3′; downstream, 5′- CGGGATCCATATATATAATATTTACAAT − 3′. The reverse primer sequences were: upstream, 5′- GCGTCGACGCCTTAGAGCT.
GCCGGAGTG − 3′; downstream, 5′- GCTCTAGAATATATATAATATTTACAAT − 3′. The cloning vector containing the target gene and the overexpression vector pCAMBIA1300 were subjected to double digestion with BamHI and XbaI restriction enzymes. The digestion products were separated by agarose gel electrophoresis. The desired gene fragment and linearized vector were excised from the gel and purified using a commercial DNA gel extraction kit. The purified target fragment and digested vector were ligated with T4 DNA ligase at 16 °C for 16–18 h. The ligation mixture was transformed into chemically competent E. coli (DH5α) cells and plated onto LB agar supplemented with 100 µg/mL ampicillin (Amp). After overnight incubation at 37 °C, individual colony was selected, and then inoculated into LB liquid medium containing 100 µg/mL Amp for culture with shaking (200 rpm) at 37 °C for 12 h.
Plasmid DNA was extracted from the cultures and verified by Sanger sequencing to confirm correct insert orientation and sequence integrity. Recombinant plasmids were transformed into E. coli (DH5α), and “positive” clones were selected for amplification. Colony PCR was performed to validate successful insertion, followed by plasmid extraction and sequencing. The confirmed recombinant plasmids (NnWOX1-1 and NnDREB2C overexpression and RNAi constructs) were introduced into Agrobacterium tumefaciens GV3101 via freeze-thaw transformation. Transformed colonies were screened by colony PCR to confirm plasmid integration. Validated Agrobacterium strains were stored at − 80 °C for subsequent plant transformation experiments.
Transient transformation of NnWOX1-1 and NnDREB2C in lotus root and S. trifolia
Preparation of materials of lotus root and S. trifolia
Lotus seeds and S. trifolia corms of similar size were selected, and the plumules of lotus and S. trifolia buds were used as tissue culture materials. After rinsing the surface mucus with clean water, the materials were disinfected with 75% alcohol, and then soaked in sterilized water with Shannong No. 1 Type I for 12 h. Subsequently, these materials were inoculated onto MS medium (containing 30 g/L sucrose, 7 g/L agar, 0.15% Shannong No. 1 Type III, 1 g/L activated charcoal, pH 5.8) and cultured aseptically for one month. Tissue culture seedlings of lotus and S. trifolia with similar growth vigor were selected for infection experiment.
The steps of instantaneous transformation
The recombinant plasmids of the NnWOX1-1 and NnDREB2C overexpression vector and RNAi vector were transformed into Agrobacterium rhizogenes K599 competent cells using the freeze-thaw method. Subsequently, the plasmids were introduced into lotus root (Nelumbo nucifera) and S. trifolia following the protocol. The Agrobacterium strains carrying the pCAMBIA1300 empty vector, overexpression vectors and RNAi vectors were activated on YEB solid medium (containing 50 mg·L⁻¹ kanamycin and 50 mg·L⁻¹ rifampicin). Single colony was selected, and subcultured on fresh YEB solid medium for expansion. Colonies were collected into a 50 mL centrifuge tube, resuspended in 20 mL YEB liquid medium, and incubated overnight at 28 °C with shaking at 200 rpm. The overnight culture was centrifuged (5 min, 6000 rpm, 4 °C), and the supernatant was discarded. The pellet was resuspended in 2 mL MES buffer (20 mM MgCl₂ + 10 mM MES), centrifuged again under the same conditions, and the supernatant was discarded. The pellet was resuspended in 1 mL MS medium, and then transferred to a sterile 50 mL tube, adjusted to 20 mL with MS medium, and supplemented with 200 µL acetosyringone (AS, 20 mg/mL). The suspension was incubated overnight at 28 °C with shaking (200 rpm) until the OD₆₀₀ reached 0.7–0.9. Sterilized lotus root and S. trifolia seedlings were wounded at internodal regions and immersed in the Agrobacterium suspension for overnight infection. Infected plants were transferred to MS liquid medium (MS + 3% sucrose + 20 mg/L AS, pH 5.8), and cultured in a growth chamber under the following conditions: 28 °C/12 h (day) and 22 °C/12 h (night), with a light intensity of 30,000 lx. After 5 days, infected plants were rinsed three times with sterile water, and the medium was replaced. Three days later, plants were washed 3–5 times with cefotaxime solution (400 mg/L) to eliminate residual Agrobacterium. Plants were transferred to fresh MS liquid medium (MS + 3% sucrose + 300 mg/L carbenicillin, pH 5.8), and maintained in the growth chamber under the same conditions.
Identification of “positive” transgenic seedlings
The leaves, stems, roots, and nodes of the transformed plants were selected for identification of “positive” plants. Confocal fluorescence microscopy was used to observe the eGFP green fluorescence in both overexpression and interference vectors. Additionally, real-time quantitative PCR was also employed to detect “positive” seedlings. For PCR identification, the extraction of RNA and synthesis of the first strand of cDNA followed the same method as described above. The upstream primer sequence for NnWOX1-1 was 5′-TCCTCAGCAATGGCGAAGAACG-3′, and the downstream primer sequence was 5′-TCGGCACCTCAGTCTCCTTCTC-3′. The upstream primer sequence for NnDEEB2C was 5′- GCAACAGACCGTCAGAC.
CATCC − 3′, and the downstream primer sequence was 5′-GGATTGTCATCTCAC.
CACGGAAG-3′. β-actin was used as the internal reference, with the upstream primer sequence 5′-GACTCTGGTGATGGTGT-3′ and the downstream primer sequence 5′-CACTTCATGATGGAGTTGT-3′. The PCR reaction system (20 µL) included: 0.8 µL each of upstream and downstream primers, 10 µL of 2× ChamQ SYBR qPCR Master Mix, 2 µL of cDNA template (200 ng/µL), and 6.4 µL of ddH2O. The PCR protocol comprised 40 cycles: 30 s at 95 °C (initial denaturation), followed by 10 s at 95 °C (denaturation), 30 s at 60 °C (annealing/extension), and a final melt curve analysis step (30 s at 95 °C, 60 s at 60 °C, and 15 s at 95 °C).
Identification downstream gene regulated by NnWOX1-1
Yeast one-hybrid
NnWOX1-1-pGADT7 was employed as bait to screen a yeast one-hybrid motif library. Following identification of “positive” clones through auxotrophic selection, DNA sequencing and multiple sequence alignment (Clustal Omega) revealed motifs interacting with NnWOX1-1. Three plasmid combinations included pGADT7-NnWOX1-1, pGADT7-NnWOX1-1 + pHIS2-p53, pGAD53m + pHIS2-p53 were independently transformed into Y187 competent cells and plated on SD/-Trp/-Leu selection medium. After 3–5 days incubation at 30 °C, six colonies were subjected to colony PCR verification. Three randomly selected clones were pooled, normalized to OD600 = 0.002, and serially diluted (0, 10, 20, 30, 40, 50, 75, and 100 mM) for spot assay on 3-amino-1,2,4-triazole (3AT)-supplemented plates. For library screening, Y187 cells pre-transformed with NnWOX1-1-pGADT7 were co-transformed with motif library plasmids, and plated on SD/-Trp/-Leu/-His medium containing 100 mM 3AT. “positive” clones from 100 mM 3AT SD-TLH plates were submitted to Nanjing Ruiyuan Biotechnology Co., Ltd. for sequencing. Consensus motif sequences were subsequently mapped to the Nelumbo nucifera genome using BLASTn tool to retrieve full-length candidate gene (NnDREB2C).
EMSA binding assay validation
The electrophoretic mobility shift assay (EMSA) for protein-DNA interaction was conducted by Nanjing Ruiyuan Biotechnology Co., Ltd. The NnWOX1-1 was expressed and secreted using the Pichia pastoris secretory expression system, followed by purification and quantification via the BCA method. A biotin-labeled DNA probe was synthesized based on a specific sequence fragment of NnDREB2C (CAATTCTGTTCTCAAATTATCTCTCCTCTCCCAACAGCGTCACCTTATCCACGTGGGAAACGTCAACCAAACGAC). The interaction between NnWOX1-1 and NnDREB2C was further validated via a series of experimental steps, including 4% native polyacrylamide gel electrophoresis (PAGE), electrophoretic transfer to a nylon membrane, membrane washing, and chemiluminescent detection of probe-protein binding signals.
Cloning of NnDREB2C
The seeds of Space Lotus 36 were dehulled and soaked in sterile water for germination. Following seed sprouting, total RNA was isolated from the leaves of lotus seedlings, and cDNA synthesis was carried out using a commercial cDNA synthesis kit according to the manufacturer’s protocol (Thermo Fisher Scientific, Waltham, US). Primers of the NnDREB2C were designed with Primer 5.0 software based on the published lotus genome sequence, and subsequently synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences were as follows:
Reverse primer: 5′-GCTCTAGACTAGGAATCCCAACCCAAAATATC-3′. The PCR amplification reaction (50 µL total volume) consisted of: 25 µL of 2× Phanta Flash Master Mix, 2 µL each of forward and reverse primers (10 µM), 2 µL cDNA template. Nuclease-free water was used to adjust the final volume. Thermal cycling conditions included: 98 °C for 30 s for initial denaturation, 35 amplification cycles of 98 °C for 30 s, 66 °C for 5 s, 72 °C for 5 s. Final extension was 72 °C for 1 min. PCR products were purified and sequenced by Nanjing Qingke Biotechnology Co., Ltd.
Expression profiling analysis of NnDREB2C
Seeds of Space Lotus 36 were dehulled and germinated in sterile water. Uniformly sized seedlings were selected and treated for 3 days with a solution containing 200 mg/L ethephon (An ethylene-releasing agent, ethephon is typically a solid that release ethylene under certain conditions), 20 µL auxin, and 20 mg/L sucrose. After treatment, seedlings were transferred to fresh water for continued cultivation. Hypocotyl tissues were selected at 0 h, 18 h, and 36 h post-transfer. Total RNA was extracted using the method described in previous protocols. To investigate tissue-specific expression patterns, samples were collected from internodes, leaves, seeds, petioles, and flowers of lotus. Reverse transcription of total RNA was performed using HiScript® III RT SuperMix. For qRT-PCR of NnDREB2C, primers were designed as follows: Forward: 5′-GCAACAGACCGTCAGACCATCC-3′, Reverse: 5′-CGGATTGTCATCTCACCACGGAAG-3′. β-actin was used as internal standard.
Forward: 5′-GACTCTGGTGATGGTGT-3′, Reverse: 5′-CACTTCATGATGGAGTTGT-3′. The qPCR reaction mixture (20 µL total volume) included: 10 µL 2× ChamQ SYBR qPCR Master Mix, 0.8 µL each of forward and reverse primers, 2 µL cDNA template, 6.4 µL RNase-free ddH₂O. PCR reaction program was 40 cycles of 94 °C for 30 s, 95 °C for 5 s, 60 °C for 60 s. Relative mRNA levels were calculated using the 2–ΔΔCtmethod. All experiments included three biological replicates to ensure reproducibility.
Determination of ethylene and auxin content
Measurement of ethylene content in transgenic plants
NnWOX1-1 and NnDREB2 overexpression and RNAi plants were thoroughly rinsed with distilled water, and the plant materials were weighed. The samples were promptly placed into 50 mL glass vials, which were immediately tightly sealed and stored in a foam box to avoid light for 7 h. Prior to sample analysis, 500 µL of a 0.5 × 10−6 mol/L ethylene standard was drawn using a 1 mL gas-tight microsyringe, and injected into a gas chromatograph (GC-7890 A, Agilent, USA) for measurement. The samples were analyzed only after the peak height of the standard ethylene stabilized. The GC conditions were as follows: 45 °C, 120 °C and 200 °C of column temperature, injector temperature, and FID detector temperature respectively; column head pressure flow rate was 40 mL/min with 2.8 mL/min column flow rate, and makeup gas flow rate was 2.5 mL/min; split ratio was 10:1, and injection volume was 500 µL. Ethylene release rates was calculated according to following formula: Ethylene concentration (µL/L) = (sample peak height/standard ethylene peak height) × standard concentration. Ethylene release rate [nL/(g·h)] = [ethylene concentration (nL/L) × container volume (mL)]/[fresh weight of sample (g) × sealing time (h)].
Measurement of IAA content in transgenic plants
The overexpression and RNAi lines of NnWOX1-1 and NnDREB2B were washed in clean water before endogenous hormone determination. Empty vector-infected lines were used as controls. 0.5 g of freeze-dried sample was ground in liquid nitrogen, and powder was transferred to 2.5 ml centrifuge tubes. A total of 500 µl extraction buffer (isopropanol: water: formic acid = 2:1:0.002) was added, followed by incubation at −20 °C for 20 min. These tubes were treated with ice-water bath sonication for 30 min. After adding 1 ml chloroform, the samples were incubated at −20 °C for 20 min, and then sonicated in ice-water bath for 5 min. The tubes were vortexed for 1 min, and centrifuged at 13,000 rpm for 5 min at 4 °C. The lower layer (900 µL, collected in two aliquots of 450 µL each into 1.5 ml centrifuge tubes) was freeze-dried. The residue was redissolved in 200 µl 80% methanol, followed by ice-water bath sonication for 1 min and vortexing for 1 min. The solution was filter-sterilized and 100 µL was transferred to insert tubes. IAA content was determined using liquid chromatography (Sigma, Shanghai, China) reported by Li et al., (2022).
Ethylene treatment
The coat of lotus root seeds was cracked and soaked in distilled water for germination. After germination, a sterile blade was used to make incisions at the hypocotyl of the seedlings. Interference vectors of NnWOLX1-1 and NnDREB2C were introduced into the lotus plants via Rhizobium rhizogenes-mediated transformation, which was followed with previously described method. Transgenic plants were treated with 300 mg/L ethephon for 48 h, and then transfered to distilled water for cultivation. The number and length of adventitious roots were measured 10 days later.
Determination of root number and length of transgenic plants
The overexpression and interference vectors were introduced into seedlings. Tissue sections were prepared, mounted on glass slides, and examined for eGFP green fluorescence using a confocal laser scanning microscope. Additionally, the relative gene expression level in “positive” seedlings was quantified by real-time quantitative PCR (qRT-PCR), and the data was analyzed and visualized using GraphPad Prism. For both the transgenic and control groups, about 6 eGFP-“positive” seedlings with comparable growth vigor were selected. The number and length of adventitious roots exceeding 1 mm were measured, and the mean values were calculated and recorded.
Analysis of fresh weight and dry weight in transgenic plants
After measuring the fresh weight of transgenic and control plants using an analytical balance, the samples had been oven-dried at 65 °C until the weight were not changed. Their dry weight was then measured to calculate the dry matter content, with averages determined.
Data analysis
The experimental data were analyzed using one-way ANOVA in GraphPad Prism 9, and bar graphs were generated. The results represent means ± SE from three independent biological experiments, and each with more than ten plants. Statistical significance was indicated as follows: “* ”represents p < 0.05; “** ”represents p < 0.01; “*** ” represents p < 0.001; “****” represents p < 0.0001.
Vanu will integrate Kuiper backhaul services into its product and services portfolio and create opportunities to expand rural coverage.
At the Africa Tech Event 2025, held in Cape Town, South Africa, on November 11, 2025, Vanu, Inc., a provider of equipment, tools, and services that enable mobile network operators to serve rural communities profitably, announced a strategic agreement with Amazon’s low Earth orbit satellite network, Project Kuiper. The partnership aims to bring low-cost, high-quality mobile connectivity to rural and underserved communities in Africa, with an initial focus on Southern Africa.
Vanu’s mission is to help close the global digital divide by connecting the unconnected. The company’s innovative coverage solutions already provide mobile connectivity to millions of people in remote regions across multiple continents. By integrating Amazon’s advanced satellite network into its product and services portfolio, Vanu will be able to significantly expand its reach while working alongside a globally trusted brand.
Project Kuiper already has more than 150 satellites in space and is quickly expanding its satellite constellation. Vanu will deploy its Coverage as a Service, leveraging Amazon’s low-latency connectivity to provide mobile broadband to rural communities starting in 2026. Using backhaul connectivity to avoid the cost and complexity of expanding the reach of traditional telecom infrastructure, Vanu will drive digital inclusion for rural unconnected communities, unlocking high-speed communications for education, healthcare, commerce, and emergency response.
“We are energized by this opportunity to accelerate our mission,” said Andrew Beard, CEO of Vanu. “Amazon’s low Earth orbit constellation gives us the scale, reliability, and performance to reach areas that have been technologically excluded for far too long. Together, we can reshape what is possible for rural connectivity worldwide.”
“Project Kuiper was created to help connect customers and communities beyond the reach of existing networks, and our backhaul solutions are an important part of that vision,” said Chris Weber, Vice President of Consumer and Enterprise for Project Kuiper. “Vanu has a proven track record connecting some of the hardest-to-reach places on the planet. Using satellite-based connectivity from Amazon, they can enable mobile network operators to reach more subscribers in more places.”
Starting in Southern Africa, Vanu and Amazon aim to demonstrate that a sustainable, scalable model for rural coverage is not only achievable but also repeatable and ready to expand. By combining disruptive terrestrial technology with global satellite broadband capabilities, the agreement sets the stage for long-term global impact.
Africa Tech Event 2025 attendees can learn more about the new partnership by visiting Vanu at stand E82.
About Vanu, Inc.
Vanu provides equipment, tools and services that enable MNOs to profitably serve the 1.2 billion people who do not have connectivity today. Vanu’s solutions combine technology and business model innovations to reduce the total cost of ownership of wireless networks. The company grew out of groundbreaking research in software radio at MIT and was founded in 1998. Vanu is the developer of the Anywave™Base Station. Anywave was the first commercial Radio Access Network (RAN) product to simultaneously support multiple cellular radio standards on the same platform and the first U.S. Federal Communications Commission (FCC)-certified software-defined radio. Vanu is headquartered in Lexington, MA, with offices in Gurgaon, India, and in Kigali, Rwanda.
This year’s pavilion also featured the exclusive 8th CIIE New Product Release Platform, which highlights the Maisons’ dedication to blending heritage and innovation.
Debuting at CIIE for the China market, the Montblanc High Artistry A Journey through Château de Versailles collection marks a new chapter for the High Artistry collection, transforming writing instruments into objets d’art. Drawing on the rich history, iconic artistry, and baroque architecture of the Palace of Versailles, the five masterpieces represent the pinnacle of craftsmanship and creativity, showcasing intricate details, inspired design, and the rare métiers d’art and mastery of Montblanc artisans. Meanwhile, Vacheron Constantin continued to pay tribute to the Chinese culture through the Métiers d’Art The Legend of the Chinese Zodiac collection, introducing two 25-piece limited editions dedicated to the Year of the Horse. Set in a 40mm case, the complex and technically sophisticated Calibre 2460 G4 is placed at the service of aesthetics, giving free rein to the artistry of the Maison’s métiers d’art specialists. In parallel, Van Cleef & Arpels presented the Lady Arpels Bal des Amoureux Automate Watch, depicting a 19th century charming guinguette through exquisitely refined grisaille enamel for the young couple’s rendezvous. At noon and midnight, the couple gets closer to each other, dancing in perfect harmony – a fleeting romance captured in motion.
“Cultural and artistic heritage has always been central to Richemont. The ‘Stories about Beauty, Elegance, and Timeless Style’ pavilion we presented at this year’s CIIE reflects this commitment.” stated Jenny Gu, CEO of Richemont China. “We are proud to stand alongside our Maisons in preserving the spirit of craftsmanship and dedicating ourselves to safeguarding and promoting both the heritage and development of our Maisons’ culture.”
Through its presence at this year’s CIIE, Richemont reaffirmed the Group’s steadfast commitment to nurturing the future of its Maisons and championing cultural heritage. Richemont remains dedicated to relentlessly pursuing excellence and innovation. Looking ahead, Richemont will further strengthen its connection with the global luxury ecosystem, continuing the legacy of its iconic creations while opening new chapters of creativity and timeless elegance.
Alexander Dennis, a subsidiary of NFI Group Inc., a leader in propulsion-agnostic bus and coach mobility solutions, today announced that its Cyber Security Management System (CSMS) has been re-certified and its Software Update Management System (SUMS) certified by the United Kingdom’s Vehicle Certification Agency (VCA) in accordance with UNECE Regulations 155 and 156 respectively.
Alexander Dennis’s commitment to the highest standards of cybersecurity encouraged the company to introduce comprehensive business-wide systems in support of the development of its next-generation electric buses, ensuring that their design, production and ongoing support is underpinned by robust protections.
UNECE Regulation 155 provides internationally recognised requirements for vehicle cybersecurity and vehicle cybersecurity management systems. The successful re-certification of Alexander Dennis’s CSMS follows an audit by VCA experts that analysed the manufacturer’s documents, tools, templates and processes against the requirements of the regulation alongside interviews with key members of staff involved in the operation of the processes.
The Alexander Dennis team has also used ISO/SAE 21434 on cybersecurity engineering for road vehicles to develop the CSMS, further following internationally recognised best practice.
Similarly, UNECE Regulation 156 defines provisions for vehicle software update management systems. Alexander Dennis’s SUMS has received initial certification following an in-depth audit by the VCA experts, underpinned by further best practice using ISO 24089 on software update engineering for road vehicles in its development.
The SUMS enables Alexander Dennis to develop and maintain software used on its buses to increase functionality where required whilst ensuring the vehicles’ safety and cybersecurity. It also helps to ensure that Alexander Dennis and its zero-emission buses are prepared for future innovations and regulatory requirements.
The dual certification follows over £1m in cybersecurity engineering investment by Alexander Dennis over the past four years.
Chris Gall, Group Engineering Director for Alexander Dennis, said: “Achieving certification under UNECE Regulations 155 and 156 is a significant milestone that reflects our unwavering commitment to cybersecurity and software integrity.
“We are proud to have put robust cybersecurity and software update management systems in place and have their compliance recognised by the VCA. This gives us a solid framework to protect our and our customers’ data, assets and technology.”
The Payments Vision Delivery Committee – which is made up of the UK Treasury, the Bank of England, the Financial Conduct Authority and the Payment Systems Regulator – has set out its strategy for the next stage of development of the UK’s next-generation retail payment infrastructure.
Five strategic outcomes set out in the committee’s report (pdf, 294kb/19pages) show its priorities which the next-generation infrastructure for retail payments will be centred around. These outcomes are that consumers and businesses have a greater choice of innovative and cost-effective payment options that meet their needs; that payments operate seamlessly as part of a diverse multi-money ecosystem with interoperability between new and existing forms of digital money; and that customers can trust their payments are protected from financial crime such as fraud.
Companies involved in the infrastructure should have fair, transparent and non-discriminatory access to it, maximising competition and scope for innovation across a payments ecosystem which is operationally and financially resilient.
These target outcomes are, the report says, building on the three key pillars – innovation, competition and security – of the National Payments Vision government published last year.
David Heffron, a financial services regulation expert at Pinsent Masons, said the new generation infrastructure needed for the vision would need to dovetail with the wider retail payment ecostructure in order to succeed.
“The regulatory authorities will play a dual role: firstly, by setting and enforcing the rules that govern and supervise the infrastructure providers themselves; and secondly, by establishing consumer-facing regulations. This includes ensuring that new payment products and services are distributed and used in ways that protect consumers and uphold high standards of safety and trust,” he said.
One of the highlighted goals of the vision report, which underpins much of the new strategic approach, is opening access to A2A (account-to-account) payment methods, allowing for smoother transactions and ecommerce between consumers and vendors.
But this would only be adopted by consumers if the potential blockers to its adoption are addressed, warned Heffron.
“Account-to-account payments are a priority, but adoption will depend on clear catalysts – such as compelling consumer incentives, trust-building measures, and seamless user experiences,” he said.
“Without these, customers will stick with familiar options like cards, and the industry risks missing a transformative moment.”
The strategy identifies that a futureproofing approach to retail payment infrastructure needs to support open banking and be inclusive by design, provide easier access for payment service providers, and support innovation and interoperability across new and growing types of digital money and payment methods, including the potential for a digital pound.
It also calls for transparent governance and secure infrastructure to seek to counter potential cyber threats and financial crime risks and to support a ‘safe openness’ approach.
The committee was established by the government as part of its new approach to delivering the next generation of retail payment infrastructure. Another part of the new governance structure is the Retail Payments Infrastructure Board that will look to translate the committee’s strategy into design under the chair of the Bank of England, with a new industry-led delivery company which leads on procurement and funding of the next generation system, closely collaborating with interbank payment system operator, Pay.UK.
“The strategy is setting out the long-term goals for the UK’s retail payments infrastructure, seeking meaningful change by supporting innovation and competition but with a ‘smooth and safe transition’ which is resilient and facilitates payment interoperability,” said Josie Day, a financial services regulation expert at Pinsent Masons.
“In the short term there will be changes to enhance the Faster Payments and Bacs systems, but looking ahead to what the second outcome envisages as a ‘diverse multi-money ecosystem’, the future infrastructure should be one that offers interoperability between new and existing forms of digital money with as little friction as possible between them, their platforms, and even potentially interoperable in future with a possible digital pound.
“The committee’s strategy refers to the next generation infrastructure as being ‘anchored’ on the five, high-level strategic outcomes. So we now have a clearer indication of the committee’s priorities for the infrastructure which are to be reflected in the work of the Retail Payments Infrastructure Board.”
Previously, PUMA and United Legwear Company LLC had a partnership, PUMA United, which focused on the sale of these products in the U.S. and Canada. PUMA held a 51% capital share in PUMA United. The products sold by PUMA United were manufactured, transported, and stored by United Legwear and its suppliers.
The move from a partnership to an exclusive licensing agreement is part of PUMA’s strategic initiative to reduce complexity within its operating model in North America and sharpen the focus on its core business in the region. It further solidifies the continued close partnership between PUMA and ULAC which has existed for 25 years. As outlined during its third-quarter results on October 30, PUMA is executing a reset and is optimizing its distribution network. At that stage, PUMA had already said it was considering a shift to a licensing model with United Legwear. Financial details of the new licensing agreement with United Legwear are not disclosed.
This transition to a licensing model aligns with market practices in North America, where the production and sale of such products are typically licensed to third parties. Through this shift, PUMA aims to create a leaner, more efficient business model while maintaining a strong brand presence in these categories via its valued long-term licensing partner. The transition also enhances transparency for investors and the capital market by enabling clearer financial reporting.
As a result of this change, PUMA United will be classified as a discontinued operation in PUMA’s financial reporting from November of 2025 onwards. Accordingly, current year and prior-period figures will be restated, with PUMA United’s results, assets, and liabilities presented separately from continuing operations. Sales generated by the partnership amounted to €427.9 million, while net earnings attributable to non-controlling interests were €60.7 million for the 2024 financial year. For additional information regarding disclosures on non-controlling interests, please refer to page 315 of the PUMA Annual Report 2024.
A total of 21 participants (11 males and 10 females) with a diverse range of responsibilities and experiences in the field of outsourced primary health services contributed to the study. The participants’ average age ranged from 23 to 52 years, with educational backgrounds from bachelor’s to doctoral levels. Participants represented three primary stakeholder groups: contractor company representatives, university-level administrators (employers), and frontline health workers (Table 1).
Table 1 Demographic characteristics of the participants
From the analysis of 1,150 open codes, 18 subthemes were identified and categorized into four main themes. (Table 2) This categorization is based on the widely-used Donabedian’s Structure–Process–Outcome (SPO) framework, which provides a robust model for evaluating the quality of healthcare. Each challenge was categorized based on its operational role and its level of influence within the framework.
In alignment with the SPO model, we categorized the challenges as follows:
Structure Challenges: This category encompasses challenges related to the foundational resources and conditions required for outsourcing success. It includes Structural and Managerial Challenges, Economic Challenges, and Human Resources Challenges. These themes reflect issues with the organizational setup, financial resources, and the quality and stability of the workforce. all of which are fundamental structural components.
Process Challenges: This category includes challenges related to the specific activities and procedures involved in delivering outsourced services. This includes sub-themes such as inefficient monitoring and performance evaluation systems, lack of transparency in contracts. These are the key operational elements that can compromise the quality of care.
Outcome Challenges: This category reflects the final results of the outsourcing initiatives. It includes Service Quality and Outcome Challenges, with sub-themes such as decreasing the quality of service and moving away from the main purpose of outsourcing, which represent the ultimate consequences for stakeholders.”
Table 2 Main themes and sub-themes of outsourcing challenges
Structural and managerial challenges
Lack of strong supporting legislation
Because outsourcing does not have a strong protection law at the level of the legislature and the parliament, and often the laws related to outsourcing are proposed and approved at the level of the university’s board of trustees, and in the implementation, the contractor company may not be able to rely on it when faced with problems. To be supported by these laws.
From the contractor’s perspective -Participant No. 17: “If each university implements its own law, we will not be able to reach a single law for outsourcing in the country. When a single law is not implemented in the country, legislators at high levels do not care to consider this issue as a package.” It should be considered complete, that is, for example, I want to implement a handover model in Torbet University. This handover model that I am doing, the ultimate goal is that I can approve it within the authority of the university’s board of trustees. Here, I can no longer go to the parliament or the ministry. I mean, when you enact a law that is at the level of your university’s board of trustees, on the other hand, the upper laws of the country may not be in line with your laws, you come up with a series of them based on what you have in mind. You take it and adapt it to the rules of the upper level. It is the same famous example that the cook who is divided into two, the food is either salty or unsalted. Like the family doctor who went to the level of the parliament, maybe we need to reach a certain form in the Ministry of Health in this handover model and go to pass as a law in the parliament some items that can be the upstream law of these contracts. Overshadow it, let’s amend it right there, for example, say that this law has been handed over, so the private sector is no longer applicable here, for example, accountable supervision is not applicable here, in this way, many interferences will be removed.”
From the employer’s perspective – Participant No. 6: “Right now, if the university’s board of trustees allows a 10-year contract with a private company, the National Audit Office intervenes and says, ‘Why did you sign a 10-year contract when you could’ve held ten separate tenders to potentially transfer services to the private sector at a lower cost?’ If this law is passed by Parliament, then the National Audit Office will no longer be able to challenge such decisions. We need strong legal frameworks to support outsourcing.”
Human resources -Participant No.2 “We don’t have strong legal protection. If any issue arises, no one stands behind us—especially when we protest about our wages or working conditions. Neither the company nor the university supports us or defends our position.”
Lack of unity of command
Unity of Command, which is sometimes referred to as the chain of command, is one of the 14 principles of artistic management by Fayol, and it means that each employee must receive orders from a superior to do any work [20]. The participants in the interview stated in this regard.
From the contractor’s perspective – Participant number 12: “Corporate personnel are recruited and selected by the university and work in the company. On the one hand, since the personnel is our company and receives a salary from us, they must be accountable to us and strive to achieve our goals. On the other hand, they must also be accountable to the university. Each employee has several bosses and receives orders from several bosses, and sometimes the orders of these bosses conflict with each other.”
From a human resources perspective-Participant No. 8: “We have 100 superiors, each of them gives an order and we have to execute it. All this is written in management books about unity of command, but the exact opposite of this is happening here. We have to answer to several people as leaders.”
Lack of competitive environment
One of the major problems of universities during outsourcing is the lack of presence and acceptance of the private sector in this field, and practically the number of companies applying for outsourcing is very few. This has caused outsourcing companies to move towards monopoly instead of a competitive environment.
From the employer’s perspective-Participant No. 1: “Due to the problems of outsourcing, applicants are very limited in outsourcing tenders, not having the right to choose has caused the competitive environment to disappear and on the one hand, instead of competition, we move towards monopoly.We are in a type 3 university, in this way, when we bid for outsourcing, we don’t have many applicants because according to our budget, it is not enough for the companies to work, that’s why the companies are limited, and we don’t have many applicants, and therefore the power We have no choice.”
From a human resources perspective –Participant No.11: We have no choice; we must work with the company currently in place. Since this is the only contracting company operating in this field, we have no alternatives. Whatever conditions they impose, we’re forced to accept them.
Customization of outsourcing
The lack of precise, clear and unified rules in the field of outsourcing and assigning this matter to each university has caused outsourcing and contracting in each university to be done according to taste and there is no fixed procedure in all universities.
From the employer’s perspective -Participant No. 10: “When there is no clear instruction to outsource services, our managers act arbitrarily and outsource services that could be managed with the organization’s forces without preliminary study and investigation. And instead, they don’t outsource some activities that private companies can do much better.”
From the contractor’s perspective– Participant No.13: “When signing a contract, there’s no clear or consistent process. Each university—and even each year as the board of directors’ changes—sets different regulations. For instance, in this term under Mr. X’s presidency, one service is outsourced and a new set of responsibilities and rules are imposed on the contracting company. In the next term, when the president changes, the rules may shift again based on the new president’s views. Moreover, outsourcing the same service might follow one set of regulations at a university, while in a neighboring province’s university, the very same service is outsourced under entirely different rules and obligations.”
Lack of transparency in contracts
Transparency in the contract means considering all possible aspects that may arise during the execution of a contract and providing a clear solution regarding these matters, but the participants in the interview stated that there are many blind spots in the current contracts that cause It does not have the necessary transparency.
From the employer’s perspective -Participant No. 5: “Not all cases have been seen in the contracts, and this makes the companies not responsible in some issues that are not clear, for example, the labor department fined the company according to the labor law, but they put the responsibility on the university. Because the companies and their representatives and even those who wrote the contract in the university, sometimes they do not have the complete authority to perform those services and they have not had executive work, they do not include a series of issues in the contracts, this causes many problems later, because the first thought We haven’t done it, now when we deal with the problem, we get confused, but if the professional forces who have done the field work are present during the contracts, the contracts will be more transparent and many of these problems will not occur anymore.”
From the contractor’s perspective- Participant No.18: The contract clauses are open to interpretation. When the university drafts the contract, the provisions are written in a vague and generalized manner. So, when challenges arise, the university offers different interpretations to avoid legal responsibility and shifts the meaning in its favor.
Inefficient performance monitoring system
One of the key challenges faced by universities in outsourcing is the absence of a robust performance monitoring and evaluation system. Without reliable verification mechanisms, it becomes difficult to accurately assess the performance of private sector providers.
From the employer’s perspective -Participant 9: “Performance evaluation refers to the process of assessing the success or failure of staff activities based on predetermined performance indicators. In the absence of strong metrics, it’s impossible to make a fair judgment about success or failure.”
From the contractor’s perspective-–Participant NO.3:“The performance evaluation indicators that have been defined are imprecise and influenced by personal preferences.”
Economic challenges
Low profitability
The next challenge was the low profitability. Due to the low pricing of outsourcing contracts, the amount paid to the company—after deducting expenses and paying staff salaries—leaves only a small sum as managerial profit for the companies. Compared to the challenges and complications associated with outsourcing, this amount is extremely limited and has significantly reduced the incentive for private sector participation in outsourcing initiatives.
From the employer’s perspective -Participant No. 15: ““With the limited resources allocated for outsourcing, our budget is quite restricted. The payment made to companies through outsourcing contracts yields little profit for them. As a result, our bargaining power is significantly weakened, reducing our influence in outsourcing arrangements.”
From the contractor’s perspective- Participant No.18: ” It has a small profit that is not worth the trouble at all, which is why no company or private sector wants to enter this field. The health sector is not very attractive for the private sector because of its nature, it is necessary to provide free services to the people and you cannot earn money in this way.”
Unfair valuation of services
During the implementation of service purchasing and pay-for-performance schemes, one of the most critical issues to address is the valuation of services. Through this process, we can achieve greater transparency in services and their value, paving the way for proper outsourcing. However, participants indicated that, at present, service valuation is being conducted unfairly.”
From the contractor’s perspective Participant No. 12: “In the beginning, when the volume and definition of the health sector services were done, this volume was correct, but what was wrong in the middle was the valuation of the services. The valuation of the services was based on savings. It was a manpower. Look, if we see everything in reality that is implemented everywhere and is not comparable, it is great. The working hours are per day. The performance-based payment system means that if you want to get the salary equal to 8 hours per day, you must also do the secretary’s work in addition to being the secretary of the boss.
From a human resources perspective -Participant No. 14 : “The tariffs set for services in the healthcare sector are not realistic. Different services vary in terms of workload and difficulty, yet they’re assigned equal tariffs and valued uniformly. As a result, we end up working much more than what we’re compensated for.”.
Short-term contracts – feeling temporary
Pursuant to the directives issued by the Ministry of Health and the National Inspection Organization, outsourcing contracts in the healthcare sector must be limited to a one-year term. This policy is intended to facilitate annual bidding processes, thereby allowing capable companies offering competitive pricing to participate. However, this short-term contractual framework has inadvertently fostered a perception of instability among service providers. Contractors frequently express concerns regarding the temporary nature of their engagement, which constrains their strategic planning and discourages long-term investment.
From the contractor’s perspective-Participant 7: “A series of items should be amended. For example, the requirement that all contracts must be signed for one year. This is a law that is not known for what purpose it was signed and what was the background of this law. Good. Obviously, no private company with any vision is willing to sign a one-year contract. As a private company, I put in the best performance and best energy to perform well, if a company comes next year and gives a lower price and wins the tender, what is my duty? I have to be unemployed.”
From a human resources perspective -Participant No. 11: “The companies sign one-year contracts with the university, so the contracts issued to us are also for one year. Each year, we live with the fear that the company may not return the next year, and we could end up unemployed”.
Lack of decision-making authority and financial independence
One of the most significant challenges in outsourcing initiatives has been the lack of decision-making authority and financial autonomy. This constraint has hindered the alignment of current outsourcing practices with the fundamental principles of effective delegation. In this regard, several participants noted:
From the employer’s perspective -Participant No. 10 : “Outsourcing has been done, but in practice, we did not proceed according to the main principles of outsourcing. The first principle in outsourcing is to give financial independence to the private sector, that is, in exchange for the money we give you, we want you to manage a special center for us. We want this quality from you, we will pay this much, and you don’t have to deal with the details anymore.”
From the contractor’s perspective-Participant No. 13: “When the company does not have the right to make decisions and practical independence in any field, it cannot have management.”
Economic instability
Economic instability in the country—including severe currency fluctuations, continuously rising costs, and the absence of a stable financial outlook—is a key factor undermining the effective implementation of healthcare service outsourcing. Such instability disrupts the efficacy of contracts, budgets, and medium- to long-term planning processes. The literature highlights that economic volatility poses a serious threat to the sustainability and quality of health services delivered by the non-governmental sector [21].
From the contractor’s perspective-Participant No. 3: “When a company comes and wins the tender and starts working, it is the first problem, because with this economic situation, prices change every day, but the company receives the same money as written in the contract in the first year. Many times, companies They face problems in supplying their equipment and consumables, which means that at the end of the year, with these prices, the company has not made a profit and has nothing left.”
From the contractor’s perspective:- Participant No.18: “Due to unstable economic conditions and the continuous rise in prices, our budget constraints have become a serious obstacle to signing new contracts with private contractors. The outsourcing payments we propose are deemed unacceptable, as they fail to align with the contractors’ current operational costs. Moreover, sudden and significant price fluctuations disrupt the contractors’ cost management, potentially leading to a decline in the quality and quantity of services delivered. As a result, we are frequently compelled to amend contracts and raise the allocated budget in order to maintain service quality.”
Human resources challenges
Insufficient motivational mechanisms
Motivation is an internal driving force that determines the intensity, direction, and persistence of an individual’s effort toward achieving a goal [22]. In other words, it is an inner state that generates energy and defines the direction and magnitude of behavior aimed at fulfilling a need [23]. Effective organizational management requires that managers, by understanding and anticipating the motivations of their workforce, actively strive to meet their needs appropriately and timely—thereby creating the conditions for genuine engagement and productivity aligned with organizational goals [24]. In this regard, participants stated:”
From the contractor’s perspective-Participant No. 3: “The forces are completely unmotivated. The company oppresses them a lot. Of course, these are educated forces, they know their rights better, but the law does not help them much. They usually compare themselves with other forces when they are so They see discrimination and difference, they become unmotivated and it affects their work.
From a human resources perspective- Participant No. 2 : “For contracted personnel, there are no specific reward items defined. Beyond our basic salary, we receive no additional benefits. As a result, we have no motivation to work harder or perform better. In fact, we have no incentive to remain in this position at all.”
Lack of job security
Perceived job security is defined as the sense of safety regarding the preservation and continuity of one’s employment. It is considered one of the key manifestations of feeling secure and, following physiological needs, constitutes the strongest level of human motivation [25]. In the workplace, this need is fulfilled by assurance of continued employment [26]. In essence, perceived job security reflects an individual’s assessment of personal, organizational, and environmental conditions, leading them to the conclusion that no particular factor threatens their job stability—and that they can confidently rely on continued employment both now and in the future. If organizations fail to incorporate modern concepts of job security, they will not be able to achieve adequate efficiency and effectiveness in employee performance. Job insecurity undermines employee empowerment across specialized competencies, practical initiative, experiential learning, job satisfaction, work ethics, and promotion opportunities. As a result, organizations are unable to meet their specialized and social expectations [27]. In this regard, several participants stated:”
From the contractor’s perspective-Participant No. 4: “The short duration of university outsourcing contracts, which are mostly one year, and on the other hand, the difficult conditions and the contract renewal process with contractors have caused most contractors to work in an environment where both they and their personnel do not feel job security. We don’t know how long to write a contract with our employee and we are losing most of our expert staff because of this.”
From a human resources perspective -Participant No. 16: “Every day we have to be stressed that the conditions of the decisions may change or a new company may come and they don’t want us anymore.”
Workforce instability
One of the key challenges in the implementation of outsourcing in primary healthcare services is the high rate of staff turnover and attrition within contractor-managed facilities. Human resource instability can lead to diminished service quality, reduced public trust, and increased training and management costs for both contractors and commissioning authorities.
International studies have also highlighted that workforce instability—particularly within outsourced structures—results in job dissatisfaction, weakened continuity of care, and inefficiencies in healthcare delivery [28]. In the conducted interviews, this challenge was discussed from multiple perspectives:”
From the employer’s perspective -Participant No. 19: “The university spends money, conducts tests, recruits, trains, spends and delivers the company, and when the contract of the company ends, these forces remain undecided. New forces come again and this process is repeated again.”
From a human resources perspective – Participant No. 8 :When there’s no guarantee for job continuity, it’s only natural to move on if a better opportunity comes along. This job lacks stability.
Feeling of inequality and being overlooked
According to Adams’ “equality” theory, job satisfaction is the result of the behavior that is done towards us compared to others. Members and employees of the organization do not work in a vacuum. They always compare themselves with “others” [29]. The basis of comparison (other) may be a member of the same work group, or another person in other departments of the organization, or even a group of people outside the organization. After evaluating how the organization deals with “person” and “other”, the results of the evaluations are compared with each other and the person compares his position with another position. The result of this comparison for a person may be a feeling of equality or inequality. Adams describes the process of comparing equality in terms of input and output ratios. Data means what the individual gives to the organization, such as education, experience, effort, and loyalty. Staff also received the person from the organization in return, such as salary, reputation, social relations and internal rewards. One part of the evaluation of the data and data is based on objective observations (for example, the rights of the individual) and the other part is based on the perception of the individual. The following relationship represents equality comparison.
A person compares his data-to-data ratio with another data-to-data ratio. In the theory of equality, it is said that employees and members of the organization, if they feel unfair towards themselves, may reduce the level of their activity or distort or disrupt the level of consumption of themselves and others (as well as efficiency). They behave in such a way that others are encouraged to work less, reduce their consumption (data) and productivity, change the reference or what the person compares himself with, or leave the organization [30]. This issue was raised as one of the challenges of the workforce and in this regard the participants had the title.
From a human resources perspective-Participant No. 20: “Official employees of the same rank and our colleagues have less workload and more income than us, We do the same work in the same room, we have the same degree, but because we are a corporate force and they are official, our salaries and benefits differ from earth to heaven.”
From a human resources perspective-Participant No. 11: “When working, they tell us that you are also an employee of the same system and you have to work for the system, but when it comes to bonuses and other benefits, it’s as if we don’t exist at all, they don’t see us at all.”
Reluctance of specialized medical and dental professionals to work in outsourced healthcare sectors
In addition to challenges arising from the limited engagement of private sector applicants in outsourcing initiatives, the recruitment of specialized personnel—particularly physicians and dentists—in underserved and remote regions poses a significant challenge for university-affiliated health services, due to the low attractiveness of such positions.
From the employer’s perspective-Participant No. 3: “The payment amount specified in the instruction (executive instruction for the provision and promotion of primary health care in urban and rural areas) is very low. As a result, general practitioners and dentists show no interest in joining. This makes it extremely difficult for us to recruit doctors for these regions. Those who do come don’t stay long because the working conditions and pay are unstable.”
Service quality and outcome challenges
Moving away from the main purpose of outsourcing
The involvement of the university in outsourcing challenges and affairs has caused outsourcing to move away from its main path and main goal.
From the employer’s perspective -Participant No. 19: “We are so worried about cost, recruitment and tendering that we forget that the purpose of outsourcing is to improve the quality and efficiency and reduce the size of the government. If we consider these goals, our work will go much better. It may take more time and patience, but in the end, we will get a good result, but unfortunately, in the discussion of outsourcing that is being done now, it seems that the main goal of outsourcing has been completely forgotten.”
From the contractor’s perspective – Participant No.4: “The university’s current focus in outsourcing is solely on costs and the quantity of services. The emphasis on expenses is so strong that quality is essentially overlooked.”
Decreasing the quality of service
One of the significant and concerning consequences of outsourcing healthcare services is the decline in the quality of services provided to the community. Although outsourcing begins with the goal of increasing efficiency, expanding service coverage, and improving quality, in practice, the lack of effective supervision, unstable financial incentives, workforce instability, and resource limitations may lead to a noticeable decrease in the quality of care.
Numerous studies have shown that without careful contract design, weak oversight, and financial pressures, outsourcing can lead to diminished professional standards and lower client satisfaction [8]. In this regard, the participants stated that:
From the employer’s perspective -Participant No.1: “Company forces that have a temporary status are not motivated to work, and sometimes they are only satisfied with the completion of programs and move more towards paperwork than they want to have real performance.”
From the contractor’s perspective Participant No.12: “We try to maintain quality, but when resources are limited and the staff is unmotivated and constantly changing, it’s difficult to sustain it.”
