Category: 3. Business

  • Latest Oil Market News and Analysis for August 22

    Latest Oil Market News and Analysis for August 22

    Oil rose after Federal Reserve Chair Jerome Powell signaled openness to an interest rate cut in September, countering an increasingly bearish supply outlook.

    West Texas Intermediate edged higher to settle above $63 a barrel, while Brent settled near $68 after Powell’s highly anticipated prepared remarks were more dovish than some investors anticipated.

    Continue Reading

  • Dollar Falls on Fed Rate Cut Expectations – The Wall Street Journal

    1. Dollar Falls on Fed Rate Cut Expectations  The Wall Street Journal
    2. EUR/USD Weekly Forecast: Hell broke loose at Jackson Hole, US Dollar fall has just begun  FXStreet
    3. Forex Today: Will Chair Powell…?  Mitrade
    4. US Dollar Index Pulls Back Off Session Highs to Trade at 97.73  FXDailyReport.Com
    5. Dollar firms as traders pare rate cut bets ahead of Powell speech  Reuters

    Continue Reading

  • Credit Spreads: Corporate Sector | Thoughts on the Market

    Credit Spreads: Corporate Sector | Thoughts on the Market

    Adam Jonas: Welcome to Thoughts on the Market. I’m Adam Jonas. I lead Morgan Stanley’s Research Department’s efforts on embodied AI and humanoid robots.

     

    Tim Hsiao: And I’m c, Greater China Auto Analyst.

     

    Adam Jonas: Today – how the global auto industry is evolving from horsepower to brainpower with the help of AI.

     

    It’s Thursday, August 21st at 9am in New York.

     

    Tim Hsiao: And 9pm in Hong Kong.

     

    Adam Jonas: From Detroit to Stuttgart to Shanghai, automakers are making big investments in AI. In fact, AI is the engine behind what we think will be a $200 billion self-driving vehicle market by 2030. Tim, you believe that nearly 30 percent of vehicles sold globally by 2030 will be equipped with Level 2+ smart driving features that can control steering, acceleration, braking, and even some hands-off driving. We expect China to account for 60 percent of these vehicles by 2030.

     

    What’s driving this rapid adoption in China and how does it compare to the rest of the world?

     

    Tim Hsiao: China has the largest EV market globally, and the country’s EV sales are not only making up over 50 percent of the new car sales locally in China but also accounting for over 50 percent of our global EV sales. As a result, the market is experiencing intense competition. And the car makers are keen to differentiate with the technological innovation, to which smart driving serve as the most effective means. This together with the AI breakthrough, enables China to aggressively roll out Level 2+ urban navigation on autopilot. In the meantime, Chinese government support and cost competitive supply chains also help.

     

    So, we are looking for China’s the adoption of Level 2+ smart driving on passenger vehicle to reach 25 percent by end of this year, and the 60 percent by 2030 versus 6 percent and the 17 percent for the rest of the world during the same period.

     

    Adam Jonas: How is China balancing an aggressive rollout with safety and compliance, especially as it moves towards even greater vehicle automation going forward?

     

    Tim Hsiao: Right.  That’s a great and a relevant question because over the years, China has made significant strides in developing a comprehensive regulatory framework for autonomous vehicles. For example, China was already implementing its strategies for innovation and the development of autonomous vehicles in 2022 and had proved several auto OEM to roll out Level 3 pilot programs in 2023.

     

    Although China has been implementing stricter requirements since early this year, for example, banning the terms like autonomous driving in advertisement and requiring stricter testing, we still believe more detailed industry standard and regulatory measures will facilitate development and adoption of Level 2+ Smart driving. And this is important to prevent, you know, the bad money from driving out goods.

     

    Adam Jonas: , One way people might encounter this technology is through robotaxis. Robo taxis are gaining traction in China’s major cities, as you’ve been reporting. What’s the outlook for Level 4 adoption and how would this reshape urban mobility?

     

    Tim Hsiao: The size of Level 4+ robotaxi fleet stays small at the moment in China, with less than 1 percent penetration rate. But we’ve started seeing accelerating roll out of robotaxi operation in major cities since early this year. So, by 2030, we are looking for  Level 4+ robotaxis to account for 8 percent of China’s total taxi and ride sharing fleet size by 2030. So, this adoption is facilitated by robust regulatory frameworks, including designated test zones and the clear safety guidance. We believe the proliferation of a Level 4 robotaxi will eventually reshape the urban mobility by meaningfully reducing transportation costs, alleviating traffic congestion through optimized routing and potentially reducing accidents.

     

    So, Adam, that’s the outlook for China. But looking at the global trends beyond China, what are the biggest global revenue opportunities in your view? Is that going to be hardware, software, or something else?

     

    Adam Jonas:  We are entering a new scientific era where the AI world, the software world is coming into far greater mental contact, and physical contact, with the hardware world and the physical world of manufacturing. And it’s being driven by corporate rivalry amongst not just the terra cap, you know, super large cap companies, but also between public and private companies and competition. And then it’s being also fueled by geopolitical rivalry and social issues as well, on a global scale. So, we’re actually creating an entirely new species. This robotic species that yes, is expressed in many ways on our roads in China and globally, but it’s just the beginning.

     

    In terms of whether it’s hardware, software, or something else – it’s all the above. What we’ve done with a across 40 sectors at Morgan Stanley is to divide the robot, whether it flies, drives, walks, crawls, whatever – we divide it into the brain and the body. And the brain can be divided into sensors and memory and compute and foundational models and simulation. The body can be broken up into actuators, the kind of motor neuron capability, the connective tissue, the batteries. And then there’s integrators, that kind of do it all – the hardware, the software, the integration, the training, the data, the compute, the energy, the infrastructure. And so, what’s so exciting about this opportunity for our clients is there’s no one way to do it. There’s no one region to do it.

     

    . So, stick with us folks. There’s a lot of – not just revenue opportunities – but alpha generating opportunities as well.

     

    Tim Hsiao: We are seeing OEMs pivot from cars to humanoids and the electric vertical takeoff in the landing vehicles or EVOTL. Our listeners may have seen videos of these vehicles, which are like helicopters and are designed for urban air mobility. How realistic is this transition and what’s the timeline for commercialization in your view?

     

    Adam Jonas:  Anything that can be electrified will be electrified. Anything that can be automated will be automated. And the advancement of the state of the art in robotaxis and Level 2, Level 3, Level 4+ autonomy is directly transferrable to aviation.   There’s obviously different regulatory and safety aspects of aviation, the air traffic control and the FAA and the equivalent regulatory bodies in Europe and in and in China that we will have to navigate, pun intended. But we will get there. We will get there ultimately because taking these technologies of automation and electronic and software defined technology into the low altitude economy will be a superior experience and a vastly cheaper experience. Point to point, on a per person, per passenger, per ton, per mile basis.

     

    So  the Wright brothers can finally get excited that their invention

     

    from 1903, quite a long time ago  could finally, really change how humans live and move around the surface of the earth, even beyond,  few tens of thousands of commercial and private aircraft that exist today.

     

    Tim Hsiao:  The other key questions or key focus for investors is about the business model. So, until now, the auto industry has centered on the car ownership model. But with this new technology, we’ve been hearing a new model, as you just mentioned, the sheer mobility and the autonomous driving fleet. Experts say it could be major disruptor in this sector. So, what’s your take on how this will evolve in developed and emerging markets?

     

    Adam Jonas: Well, we think when you take autonomous and shared and electric mobility all the way – that transportation starts to resemble a utility like electricity or water or telecom; where the incremental mile traveled is maybe not quite free, but very, very, very low cost. Maybe only the marginal cost of the mile traveled may only just be the energy required to deliver that mile, whether it’s a renewable or non-renewable energy source.

     

    And the relationship with a car will change a lot. Individual vehicle ownership may go the way of horse ownership. There will be some, but it’ll be seen as a nostalgic privilege, if you will, to own our own car. Others would say, I don’t want to own my own car. This is crazy. Why would anyone want to do that?

     

    So, it’s going to really transform the business model. It will, I think, change the structure of the industry in terms of the number of participants and what they do. Not everybody will win. Some of the existing players can win. But they might have to make some uncomfortable trade-offs for survival.  And for others, the car – let’s say terrestrial vehicle modality may just be a small part of a broader robotics and then physical embodiment of AI that they’re propagating; where auto will just be a really, really just one tendril of many, many dozens of different tendrils. So again, it’s beginning now. This process will take decades to play out. But investors with even, you know, two-to-three or three-to-five-year view can take steps today to adjust their portfolios and position themselves.

     

    Tim Hsiao:  The other key focus of the investor over the market would definitely be the geopolitical dynamics. So, Morgan Stanley expects to see a lot of what you call coopetition between global OEMs and the Chinese suppliers. What do you mean by coopetition and how do you see this dynamic playing out, especially in terms of the tech deflation?

     

    Adam Jonas: In order to reduce the United States dependency on China, we need to work with China. So, there’s the irony here. Look, in my former life of being an auto analyst, every auto CEO I speak to does not believe that tariffs will limit Chinese involvement in the global auto industry, including onshore in the United States.

     

    Many are actively seeking to work with the Chinese through various structures  give them an on-ramp to move onshore to produce their, in many cases, superior products, but in U.S. factories on U.S. shores with American workers. That might lead to some, again, trade-offs.

     

    But our view within Morgan Stanley and working with you is we do think that there are on-ramps for Chinese hardware, Chinese knowhow, and Chinese electrical vehicle architecture, but while still being sensitive to the dual-purpose AI sensitivities around  software and the AI networks that for national security reasons, nations want to have more control over.

     

    So  that’s a long-winded way of saying we want the Chinese body, but we may need to find a way to have the U.S. brain in that body. And I actually am hopeful and seeing some signs already that that’s going to happen and play out over the next six to 12 months.

     

    Tim Hsiao: I would say it’s clear that the road ahead isn’t just smarter, it’s faster, more connected, and increasingly autonomous.

     

    Adam Jonas: That’s correct, Tim. I could not agree more.  Thanks for joining me on the show today.

     

    Tim Hsiao: Thanks, Adam. Always a pleasure.

     

    Adam Jonas: And to our listeners, thanks for listening. Until next time, stay human and keep driving forward. If you enjoy Thoughts on the Market,  please leave us a review wherever you listen and share the podcast with a friend or colleague today.

     

     

    Continue Reading

  • Enhancing adipogenesis in Wharton’s jelly multipotent mesenchymal stromal cells through lipidomic insights and fatty acid supplementation

    Enhancing adipogenesis in Wharton’s jelly multipotent mesenchymal stromal cells through lipidomic insights and fatty acid supplementation

    Isolation of WJ-MSCs

    Discarded human umbilical cords were obtained at the University Hospital Plzen (Plzen, Czech Republic) from healthy full-term neonates (N = 4) after spontaneous delivery, according to all ethical guidelines. About 10 cm of the umbilical cord was aseptically collected, placed in sterile PBS with antibiotic–antimycotic solution at 4 °C, and transported to the laboratory within 24 h. After washing several times in PBS and brief exposure to 10% Betadine (EGIS Pharmaceuticals PLC, Budapest, Hungary), blood vessels were removed, the remaining Wharton’s jelly tissue was chopped into small fragments and the cells were isolated by enzymatic digestion in PBS-AA solution containing 0.26 U/ml Liberase-TM™ (Roche Custom Biotech, Mannheim, Germany) and 1 mg/ml hyaluronidase at 37 °C with constant shaking for 2 h. After removing undigested fragments with 40-µm cell strainers, cells were centrifuged at 450 × g for 10 min6,38.

    Isolation of AT-MSCs

    AT samples were obtained from healthy volunteers (N = 4) who had undergone liposuction procedures for aesthetic reasons and processed as previously described6. Briefly, the lipoaspirate was repeatedly washed in PBS and enzymatically digested by 0.3 PzU/ml collagenase type I (Thermo Fisher Scientific) at 37 °C for 2 h with constant shaking. After centrifugation at 200 × g for 10 min, the stromal vascular fraction was washed twice with PBS and expanded.

    Cell culture and expansion

    Primary cell suspensions were diluted in a complete culture medium containing α-MEM (Gibco®, Thermo Fisher Scientific), 5% human platelet lysate (HPL, Bioinova a.s.), penicillin/streptomycin (Gibco®, Thermo Fisher Scientific), and GlutaMAX (Gibco®, Thermo Fisher Scientific). Cells were cultured at 37 °C in a humidified atmosphere with 5% CO2. Regular media changes were done twice a week. After reaching near-confluence, cells were harvested using the 0.05% Trypsin/EDTA solution (Gibco®, Thermo Fisher Scientific) and reseeded onto a fresh plastic surface (Nunc, Roskilde, Denmark) at a density of 5 × 103 cells/cm2. Cells in passage 2 were cryopreserved in culture medium, supplemented with 10% DMSO, using a 1 °C/min cooling rate down to 80 °C, and stored at -196 °C until further use. Before use, the cryopreserved cell cultures were thawed at 37–40 °C and additionally expanded in the α-MEM medium containing GlutaMAX, supplemented with 10% fetal bovine serum (FBS), 100 units/mL of penicillin, and 100 µg/mL of streptomycin (all from Gibco®, Thermo Fisher Scientific). Cells from passages 3–5 were used for subsequent experiments.

    Adipogenic differentiation

    For adipogenic differentiation, AT- and WJ-MSCs were cultured for 21 days in a medium composed of α-MEM, containing 10% FBS, penicillin/streptomycin, GlutaMAX, 0.5 mM 3-isobutyl-1-methylxanthine, 0.1 µM dexamethasone, 0.1 mM indomethacin, and 10 µg/ml insulin (all from Merck KGaA, Darmstadt, Germany). The medium was replaced every 3 days.

    In separate experiments, the induction medium was additionally supplemented by 100 µM Oleic Acid (OA, Merck KGaA), 100 µM Linoleic acid (LA, Merck KGaA), or their mixture (50 µM each). Before the application, OA and LA were dissolved in DMSO and then complexed with albumin in FBS, resulting in an estimated BSA: FA ratio of ~ 2.4:1 to minimize toxicity while ensuring efficient binding and a minimal amount of unbound fatty acids. The final DMSO concentration during cell culture comprised 0.1%. After 21 days of culture, WJ-MSCs were harvested by trypsinization and centrifuged. The pellets were washed once with PBS and stored at − 80 °C for subsequent qPCR analysis. The other part of cell cultures was used for Nile red staining and TG content determination.

    Nile red staining and fluorescence microscopy

    MSCs were fixed in a 4% buffered formalin for 30 min at 4 °C and stained with a Nile Red (1 µg/ml in PBS) solution (Merck KGaA) according to the manufacturer’s instructions. The cells were assessed using a fluorescent microscope (Leica, Germany).

    Determination of intracellular triglyceride content

    The triglyceride (TG) content in AT- and WJ-MSC culture after adipogenic differentiation was determined using the Triglycerides Quantification Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Briefly, the adherent cells were washed twice with PBS and lysed using the lysis buffer provided in the kit, followed by incubation on ice for 10 min to ensure efficient cell disruption. The lysates were centrifuged at 12,000 × g for 10 min at 4 °C, and the supernatants were collected for analysis. Triglyceride levels were measured using a colorimetric assay in the Tecan Infinite 200 (Tecan, Männedorf, Switzerland) microplate reader at 540 nm absorbance. TG concentrations were calculated from a standard formula:

    $$:TG:left(frac{mmol}{L}right)=:frac{ODSample:-:ODBlank}{ODStandard:-:ODBlank}times:Cstand:times:f$$

    where

    Cstand: Concentration of standard (2.26 mmol/L);

    f: Dilution factor of the sample before the test (equals 1 in our experiments).

    The data was presented as Mean ± SD of 4 independent donor samples assessed in duplicates.

    Analysis of lipidomic profile

    The lipidomic profile of cells was explored by the liquid chromatography-mass spectrometry (LC-MS) in the Service Department of Metabolomics of the Institute of Physiology of the CAS, Prague, Czech Republic. Briefly, cells were grown on 6-well plates, treated as required, quickly washed with PBS, snap-frozen, and stored at − 80 °C. Metabolites were extracted using a biphasic solvent system of cold methanol, methyl tert-butyl ether, and water39.

    An aliquot of the bottom (polar) phase was collected and cleaned using an acetonitrile/isopropanol mixture. After evaporation, the dry extract was resuspended in 5% methanol with 0.2% formic acid, followed by separation in an Acquity UPLC HSS T3 column (Waters, Milford, MA, USA). Another aliquot of the bottom phase was evaporated, resuspended in an acetonitrile/water mixture, and separated in an Acquity UPLC BEH Amide column. Metabolites were detected in negative and positive electrospray ion mode (Thermo Q Exactive Plus instrumentation)40. Signal intensities were normalized to the respective total ion count (TIC) before subsequent statistical analysis.

    Quantitative real-time PCR

    To assess the efficacy of adipogenic differentiation, specific human marker genes were selected:

    • CEBPA(CCAAT/enhancer-binding protein alpha, Hs.PT.58.4022335.g),

    • PPARG(Peroxisome proliferator-activated receptor gamma, Hs.PT.58.25464465),

    • FABP4(Fatty Acid Binding Protein 4, Hs.PT.58.20106818),

    • LPL(Lipoprotein lipase, Hs.PT.58.45792913).

    Total RNA was extracted from cell pellets using the Total RNA Purification Kit (Norgen Biotek Cor., Canada), following the manufacturer’s protocol. The concentration and purity of RNA were assessed using a NanoDrop™ 2000/2000c Spectrophotometer (Thermo Fisher Scientific). The RNase-Free DNase I Kit (Norgen Biotek Corp., Canada) was used to improve RNA purity. RNA samples with an absorbance ratio (A260/A280) between 1.9 and 2.1 were used for subsequent experiments.

    For the quantitative conversion of RNA into single-stranded cDNA, we applied a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). RNA samples were normalized to the same amount of input RNA for reverse transcription. Reverse transcription was performed using the C1000 Touch™ Thermal Cycler (Bio-Rad, USA) set to these conditions: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, and 4 °C for the end.

    Quantitative real-time PCR was carried out using the CFX384 Touch Real-Time PCR Detection System (Bio-Rad, USA) following these cycling conditions: initial denaturation at 95 °C for 30 s, followed by 44 cycles of denaturation at 95 °C for 5 s, and annealing at 60 °C for 30 s extension for 72 °C for 10 s.

    The following primer pairs (PrimeTime® qPCR Primers, IDT) were used in the study:

    Genes

    Forward primers (5´-3´)

    Reverse primers (5´-3´)

    CEBPA

    CCACGCCTGTCCTTAGAAAG

    CCCTCCACCTTCATGTAGAAC

    PPARG

    GTTTCAGAAATGCCTTGCAGT

    GGATTCAGCTGGTCGATATCAC

    LPL

    GAGAAGCTATCCGCGTGA

    CCTTGGAACTGCACCTGTAG

    FABP4

    ACTTGTCTCCAGTGAAAACTTTG

    ATCACATCCCCATTCACACT

    PPIA

    GTGGCGGATTTGATCATTTGG

    CAAGACTGAGATGCACAAGTG

    The expression of target genes was normalized to PPIA, which was selected as the housekeeping gene due to its stable expression across conditions.

    Statistical analysis

    Multivariate analysis of lipidomic data was performed in MetaboAnalyst 5.029. Shares of fatty acids and various TG species in non-induced WJ-MSCs and AT-MSCs were compared using an unpaired t-test. For multiple group comparisons in experiments involving induced cell cultures, ordinary one-way ANOVA followed by Sidak’s post hoc test was performed. Data analysis and visualization were done using Prism 10.2.3. Statistically significant p-values are presented in figures as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

    Continue Reading

  • Fitch Affirms Southern Company and Subsidiaries' Ratings; Revises Georgia Power's Outlook to Stable – Fitch Ratings

    1. Fitch Affirms Southern Company and Subsidiaries’ Ratings; Revises Georgia Power’s Outlook to Stable  Fitch Ratings
    2. Southern Company (SO) Expands $76 Billion Capital Plan Amid Rising Data Center Power Demand  MSN
    3. Southern Company’s Strategic Capital Expansion and Regulatory Tailwinds in Q2 2025: A Pathway to Sustained Earnings and Credit Resilience  AInvest

    Continue Reading

  • Trump says US to take 10 percent stake in Intel | Technology News

    Trump says US to take 10 percent stake in Intel | Technology News

    The extraordinary development follows a meeting between CEO Lip-Bu Tan and Trump after he called for Tan’s removal.

    The United States government will take a 10 percent stake in Intel under an agreement with the struggling chipmaker, President Donald Trump has said, marking the latest extraordinary intervention in corporate affairs.

    Trump made the announcement on Friday. Intel, whose shares rose more than 6 percent, declined to comment.

    The development follows a meeting between CEO Lip-Bu Tan and Trump earlier this month that was sparked by Trump’s demand for the Intel chief’s resignation over his ties to Chinese firms.

    “He walked in wanting to keep his job and he ended up giving us $10bn for the United States,” Trump said on Friday.

    The move marks a clear change of direction and also follows a $2bn capital injection from SoftBank Group in what was a major vote of confidence for the troubled US chipmaker in the middle of a turnaround.

    Federal backing could give Intel more breathing room to revive its loss-making foundry business, analysts said, but it still suffers from a weak product roadmap and challenges in attracting customers to its new factories.

    Trump, who met Tan on August 11, has taken an unprecedented approach to national security.

    The US president has pushed for multibillion-dollar government tie-ups in semiconductors and rare earths, such as a pay-for-play deal with Nvidia and an arrangement with rare-earth producer MP Materials to secure critical minerals.

    Tan, who took the top job at Intel in March, has been tasked to turn around the US chipmaking icon, which recorded an annual loss of $18.8bn in 2024 — its first such loss since 1986. The company’s last fiscal year of positive adjusted free cash flow was 2021.

    Earlier this week, US Senator Bernie Sanders supported the plan. He and Senator Elizabeth Warren had previously said that the US Treasury Department should receive a warrant, equity stake or senior debt instrument from any company that receives government grants like Intel had under the 2022 CHIPS and Science Act, which sought to lure chip production away from Asia and boost US domestic semiconductor output with $39bn in subsidies.

    A formal announcement of the investment is expected later on Friday.

    Continue Reading

  • Oil prices rise, make weekly gains as Ukraine peace process stalls – Reuters

    1. Oil prices rise, make weekly gains as Ukraine peace process stalls  Reuters
    2. Oil prices set for weekly gains as Ukraine peace process stalls  Reuters
    3. Oil prices fall on talks to end Russian invasion of Ukraine  Dawn
    4. Inventory Drop Boosts WTI, Rate Cut Uncertainty Holds Markets  FOREX.com
    5. WTI crude oil futures settled at $63.66  TradingView

    Continue Reading

  • Fitch Affirms the United States of America at 'AA+'; Outlook Stable – Fitch Ratings

    1. Fitch Affirms the United States of America at ‘AA+’; Outlook Stable  Fitch Ratings
    2. Tariffs and policy uncertainty weigh on U.S. economy: economists  CNBC
    3. Economic impact of tariffs will be key for US rating, says S&P analyst  Reuters
    4. Effects of US policies adding downside risks to economy: S&P Global  Fibre2Fashion
    5. S&P affirms US credit rating as Trump tariffs boost government revenues  Financial Times

    Continue Reading

  • Real-World Data Highlight Feasibility of Venetoclax Plus Obinutuzumab In First-Line CLL With Comorbidities

    Real-World Data Highlight Feasibility of Venetoclax Plus Obinutuzumab In First-Line CLL With Comorbidities

    Image credit:© kamonrat

    -stock.adobe.com

    Findings from a retrospective, real-world analysis conducted through the Polish Adult Leukemia Group showed that first-line treatment with the combination of venetoclax (Venclexta) and obinutuzumab (Gazyva) was efficacious and generally well tolerated in patients with chronic lymphocytic leukemia (CLL) who had significant preexisting comorbidities.1

    Data showed that response-evaluable patients (n = 199) achieved an overall response rate (ORR) of 97.4%, including a complete remission (CR) rate of 32.7%. Three patients experienced stable disease as best response. In 2 patients who had progressive disease, 1 had Richter transformation to diffuse large B-cell lymphoma.

    At a median follow-up of 25.9 months (95% CI, 24.5-27.9), the median progression-free survival (PFS) and overall survival (OS) were both not reached. The estimated 1- and 2-year PFS rates were 93.9% (95% CI, 90.7%-97.2%) and 88.4% (95% CI, 83.9%-93.2%), respectively. The respective 1- and 2-year OS rates were 94.3% (95% CI, 91.3%-97.5%) at and 92.7% (95% CI, 89.2%-96.4%).

    Regarding safety (n = 220), 99.5% of patients had completed therapy, including 78.1% who received the full 12 cycles of protocol treatment. Grade 3 or 4 adverse effects (AEs) occurred in 68.6% of patients. Additionally, 82.7% of patients received a final dose of venetoclax at 400 mg and did not require any dose reductions. In 15.9% of patients who had venetoclax dose reductions, the primary reasons comprised hematologic toxicity (74.3%), infections (5.7%), liver toxicity (5.7%), patient decision (5.7%), diarrhea (2.9%), and fatigue (2.9%). Notably, venetoclax was not given to 2 patients due to infection or immune thrombocytopenia after receiving obinutuzumab.

    “The combination of venetoclax [and] obinutuzumab in de novo CLL is an effective and generally well-tolerated first-line therapy in…patients with significant comorbidities under real-world conditions,” lead study author Klaudia Zielonka, MD, of the Department of Hematology, Transplantation and Internal Medicine, at the Medical University of Warsaw in Poland, and colleagues wrote in a publication of the data. “TP53 aberrations did not affect early treatment outcomes; however, longer follow-up is mandatory.”

    Real-World Study Background and Breakdown

    The combination of venetoclax (Venclyxto) and obinutuzumab is currently approved in the European Union for the treatment of patients with previously untreated CLL, based on data from the phase 3 CLL14 study (NCT02242942).2 In the United States, the combination was approved by the FDA for patients with CLL or small lymphocytic lymphoma in May 2019.3

    However, study authors noted that prospective clinical trial inclusion and exclusion criteria could create patient selection bias, and they explained that real-world data could help confirm the efficacy and safety of the combination in an older patient population often burdened by comorbidities.1

    The retrospective study included adult patients with previously untreated CLL who started treatment with venetoclax plus obinutuzumab in Poland between November 2021 and August 2024. Patients needed to have an ECOG performance status of 2 or less, along with comorbidities, defined as a CIRS total score of more than 6 and/or a creatinine clearance of more than 30 mL/min and less than 70 mL/min.

    Patients received obinutuzumab at 100 mg on cycle 1, day 1, and 900 mg on cycle 1, day 2, followed by a 1000-mg dose on days 8 and 15 of cycle 1, then day 1 of cycles 2 to 6. Venetoclax was ramped up at daily doses of 20 mg daily during the first week and gradually increased to 400 mg after 5 weeks, starting at day 22 of cycle 1. Patients received venetoclax for up to 12 cycles or until disease progression and/or unacceptable toxicity.

    ORR, CR rate, PFS, OS, and safety were the primary objectives of the study.

    In the safety population, patients had a median age of 70 years (range, 45-86), and 25.5% were at least 75 years of age. Most patients were male (60.9%), had an ECOG performance status of 1 (56.0%), had Binet stage C disease (50%), had Rai high stage disease (51.4%), and were at intermediate risk for tumor lysis syndrome (51.6%).

    Notably, 10% of evaluable patients (n = 190) harbored 17p deletions and/or TP53 mutations. IGHV mutational status was evaluated in 51 patients, and 72.5% of this group harbored IGHV mutations. The median time from CLL diagnosis to treatment was 1.6 years (range, 0-19).

    Efficacy Outcomes After Early Discontinuation

    In patients who discontinued therapy early (n = 36) for reasons other than disease progression or death, 63.9% had decreased renal function, and 83.3% had a CIRS index higher than 6.

    The ORR in this subgroup was 85.7%; however, the estimated 24-month PFS rate was 49.4% (95% CI, 34.5%-70.6%) in this population (HR vs patients who completed protocol therapy, 12.024; 95% CI, 5.498-26.297; P < .001). The 24-month OS rate was 66.5% (95% CI, 52.8%-83.7% [HR: 12.502; 95% CI, 4.720-33.116; P < .001]).

    Additional Safety Data

    The most common any-grade AEs included neutropenia (83.2%), thrombocytopenia (57.3%), anemia (54.5%), febrile neutropenia (10%), upper respiratory tract infections (7.7%), pneumonia other than COVID-19 (8.6%), COVID-19 hospitalization (11.8%), COVID-19 pneumonia (6.4%), autoimmune hemolytic anemia (4.1%), immune thrombocytopenia (2.7%), diarrhea (6.8%), liver toxicity (1.8%), increased alanine aminotransferase levels (6.4%), increased aspartate aminotransferase levels (7.3%), increased alkaline phosphatase levels (4.1%), increased gamma-glutamyl transferase (2.3%), atrial fibrillation (1.4%), acute coronary syndrome (0.5%), increased bilirubin concentration (2.3%), cutaneous toxicity (2.7%), obinutuzumab infusion-related reactions (9.5%), secondary malignancies (2.3%), fever (2.3%), peripheral edema (1.4%), and central nervous system disorders (0.9%).

    Any-grade biochemical TLS occurred at a rate of 19.5%, and the rate of clinical TLS was 3.6%.

    References

    1. Zielonka K, Izdebski B, Drozd-Sokołowska J, et al. Venetoclax and obinutuzumab in first-line treatment of unfit patients with CLL – real-life data analysis of the Polish Adult leukemia group. Leuk Lymphoma. Published online August 1, 2025. doi:10.1080/10428194.2025.2535693
    2. Venclyxto. European Medicines Agency. Accessed August 21, 2025. https://www.ema.europa.eu/en/documents/product-information/venclyxto-epar-product-information_en.pdf
    3. FDA approves venetoclax for CLL and SLL. FDA. May 15, 2019. Accessed August 21, 2025. https://www.fda.gov/drugs/resources-information-approved-drugs/fda-approves-venetoclax-cll-and-sll

    Continue Reading

  • Dollar tumbles as Powell signals possible September rate cut

    NEW YORK (Reuters) -The dollar dropped broadly on Friday after Federal Reserve Chair Jerome Powell pointed to a possible rate cut at the central bank’s September meeting but stopped short of committing to such a move.

    The dollar index, which measures the greenback against a basket of currencies including the yen and the euro, was last down 0.96% on the day at 97.66, after trading around 98.7 before Powell’s comments. 

    The euro gained 1.06% to $1.1728 and reached $1.1742, the highest since July 28. Against the Japanese yen, the dollar weakened 1.08% to 146.77.

    “While the labor market appears to be in balance, it is a curious kind of balance that results from a marked slowing in both the supply of and demand for workers. This unusual situation suggests that downside risks to employment are rising,” Powell said. 

    “And if those risks materialize, they can do so quickly,” he told an audience of international economists and policymakers at the Fed’s annual conference in Jackson Hole, Wyoming.

    Karl Schamotta, chief market strategist at Corpay in Toronto, said Powell’s message was far more dovish than markets had anticipated. 

    “The dollar is plunging, odds on a September rate cut are rising and market participants are clearly bracing for more easing to come,” he said.

    Traders are now pricing in 85% odds of an interest rate cut at the Fed’s September 16-17 policy meeting, up from 72% earlier on Friday, according to the CME Group’s FedWatch Tool. They are also pricing in 54 basis points of cuts by year-end, up from 48 basis points.

    “The burden of proof is now clearly on the data to prevent a September cut,” Bank of America economists said in a report on Friday.

    Traders had been raising their expectations for a cut in September after an unexpectedly weak jobs report for July. Consumer price data showing limited inflation increases from tariffs so far added to the view.

    But hotter-than-expected producer price inflation and some other economic releases, including a strong business activity survey for August, had led them to temper their view.

    Now, labor market data is expected to be the main driver of Fed policy going forward.

    “What he’s really saying there is that they are bracing for a pivot in labor market conditions and that the second half of the Fed’s mandate has suddenly become much, much more important in terms of defining policy settings,” said Schamotta.

    The dollar was headed on Friday for its largest daily loss against the euro and yen since August 1, when the July jobs report was released.

    The dollar has also been under pressure at times this week on concerns about Fed independence after U.S. President Donald Trump indicated he may seek to fire Fed Governor Lisa Cook.

    Trump on Friday said he would fire Cook if she doesn’t resign, after calling for her resignation on Wednesday on the basis of allegations about mortgages she holds in Michigan and Georgia.

    “Trump’s words on Cook… are once again raising concerns over the Fed’s independence as it becomes more clear the administration may be looking to remake the Fed in its own image,” said Helen Given, FX trader at Money USA in Washington.

    Trump has repeatedly criticized Powell for being too slow to cut rates, and traders expect he will replace Powell with a more dovish appointment when his term ends in May.

    But Powell may stay on the board of governors, which would limit how many appointments Trump may make and could crimp plans to form a more dovish composition of policymakers unless there are more departures.

    In other currencies, sterling strengthened 0.86% to $1.3527. The Australian dollar gained 1.14% versus the greenback to $0.6492.

    In cryptocurrencies, bitcoin gained 4.10% to $117,035.

    (Reporting by Karen Brettell; Additional reporting by Laura Matthews; Editing by Chizu Nomiyama, Clelia Oziel and Andrea Ricci)

    Continue Reading