Category: 3. Business

  • mFOLFIRINOX Does Not Significantly Improve Survival Vs mFOLFOX6 in HER2– Metastatic Gastric/GEJ Adenocarcinoma

    mFOLFIRINOX Does Not Significantly Improve Survival Vs mFOLFOX6 in HER2– Metastatic Gastric/GEJ Adenocarcinoma

    mFOLFIRINOX vs mFOLFOX6 in Gastric/GEJ
    Cancer | Image Credit: © Ashling Wahner &
    MJH Life Sciences Using AI

    mFOLFIRINOX (irinotecan plus oxaliplatin, leucovorin, and fluorouracil [5-FU]) significantly improved objective response rate (ORR) but not progression-free survival (PFS) or overall survival (OS) vs mFOLFOX6 (oxaliplatin, leucovorin, and 5-FU) in patients when used as a frontline treatment of patients with HER2-negative metastatic gastric and gastroesophageal adenocarcinoma, according to data from the phase 3 IRIGA trial (NCT04442984) presented at the 2025 ESMO Gastrointestinal Cancers Congress.1

    The median PFS was numerically improved with mFOLFIRINOX (triplet; n = 157) vs mFOLFOX6 (doublet; n = 161), at 7.20 months (95% CI, 6.82-7.58) and 6.83 months (95% CI, 5.76-7.90), respectively (HR, 0.81; 95% CI, 0.63-1.04; P = .266). However, a significant improvement was observed in those with grade 1 or 2 disease, at a median of 9.9 months (95% CI, 5.6-14.2) vs 8.4 months (95% CI, 7.5-9.2), respectively (HR, 0.55; 95% CI, 0.30-0.99). The median OS with mFOLFIRINOX vs mFOLFOX6 was 13.40 months (95% CI, 11.76-15.04) and 13.23 months (95% CI, 10.86-15.60; HR, 0.87; 95% CI, 0.66-1.15; P = .322).

    The partial response rates in the mFOLFIRINOX and mFOLFOX6 arms were 31.2% vs 19.3% (P = .014), the stable disease rates were 43.3% vs 47.8% (P = .419), disease control rates were 74.5% vs 67.1% (P = .144), and the progressive disease rates were 20.4% vs 31.7% (P = .022); 4.5% and 1.2% of patients in the respective arms were not evaluable for response.

    “Despite improved response, no significant benefit in OS or PFS was observed in the overall population. A significant improvement in PFS was seen in patients with grade 1 or grade 2 gastric adenocarcinoma treated with mFOLFIRINOX,” Daria Gavrilova, MD, of Russian Federation, said in a presentation of the data. “mFOLFIRINOX was associated with a higher incidence of treatment-related toxicities.”

    A Spotlight on IRIGA

    The single-center, open-label, randomized phase 3 study enrolled patients with advanced gastric or gastroesophageal HER2-negative adenocarcinoma who had an ECOG performance status of 0 to 2 and who had not previously received systemic therapy for advanced disease. Adjuvant therapy was permitted if received longer than 6 months before the study.

    Study participants were randomly assigned 1:1 to mFOLFIRINOX vs mFOLFOX6. Those in the mFOLFIRINOX arm received 180 mg/m2 of irinotecan, 85 mg/m2 of oxaliplatin, 200 mg/m2 of leucovorin, and 250 mg/m2 of 5-FU plus 2200 mg/m2 every 2 weeks. Those in the mFOLFOX6 arm received 85 mg/m2, 400 mg/m2 of leucovorin, and 400 mg/m2 of 5-FU plus 2400 mg/m2 every 2 weeks. Patients received 9 cycles of chemotherapy and then underwent observation. They did not receive maintenance treatment.

    Patients were stratified based on age (under 65 years vs 65 years or older), primary tumor (present vs resected), histological differentiation (G1 to G2 vs G3 to signet ring cell carcinoma), number of metastatic sites (1 to 2 vs 3 or more), tumor location (gastroesophageal junction vs stomach), and ECOG performance status (0 to 1 vs 2).

    The primary end point of the study was PFS, and secondary end points included OS, ORR, toxicity, efficacy across Lauren subtypes, and efficacy by tumor grade. Investigators also sought to detect a hazard ratio of 0.73 with 82% power, 1-sided α = 0.05, and a 10% dropout rate, which translates to 163 patients per group.

    A total of 326 patients were enrolled in the study, and the median follow-up was 22.4 months. The median patient age was 57 years (range, 20-75) with mFOLFIRINOX vs 58 years (range, 34-74) with mFOLFOX6, with 24.2% and 29.8% of patients aged 65 years or older. Slightly more than half of the patients were male (57.3% vs 55.3%). Most patients had an ECOG performance status of 1 (87.9% vs 83.2%), had a primary tumor site of the stomach (87.3% vs 85.7%), histological grade 3 plus signet-ring cell (78.9% vs 72.1%), and 1 to 2 metastatic sites (73.2% vs 75.8%). Moreover, 5.7% and 7.5% of those in the mFOLFIRINOX and mFOLFOX6 arms had prior primary tumor resection.

    Additional Subgroup Analysis Data

    The hazard ratio (HR) for PFS in women was 0.83 (95% CI, 0.59-1.16) and 0.79 (95% CI, 0.55-1.16) in men. In those under 65 years, the HR for PFS was 0.77 (95% CI, 0.58-1.03); in those aged 65 years or older, the HR for PFS was 0.79 (95% CI, 0.46-1.36). In those with an ECOG performance status of 0 to 1 or 2, the HRs for PFS were 0.81 (95% CI, 0.63-1.05) and 0.83 (95% CI, 0.25-2.79), respectively. In those with histological grade 3 plus signet ring cell disease, the HR for PFS was 0.83 (95% CI, 0.62-1.10). In those with GEJ or stomach cancer, the HRs for PFS were 0.90 (95% CI, 0.46-1.79) and 0.79 (95% CI, 0.60-1.04), respectively.

    Moreover, in those with Lauren classifications of intestinal, diffuse, or mixed, the respective HRS for PFS were 0.78 (95% CI, 0.50-1.22), 0.72 (95% CI, 0.49-1.04), and 0.99 (95% CI, 0.58-1.69). In those with no more than 2 organs with metastases, the HR for PFS was 0.81 (95% CI, 0.60-1.08); in those with 3 or more organs with metastases, the HR for PFS was 0.73 (95% CI, 0.45-1.19). The HRs for PFS in those who had prior tumor resection vs those who did not were 0.69 (95% CI, 0.24-1.92) and 0.79 (95% CI, 0.61-1.02).

    Safety Revelations

    The most common grade 1 to 2 adverse effects (AEs) reported in the mFOLFIRINOX and mFOLFOX6 arms were asthenia (88.1% vs 87.4%; P = .736), nausea (41.4% vs 24.5%; P = .001), diarrhea (40% vs 10.1%; P < .001), hepatotoxicity (36.6% vs 31.5%; P = .333), thrombocytopenia (25.3% vs 24.5%; P = .869), neutropenia (23.3% vs 23.6%; P = .907), peripheral neuropathy (18.7% vs 20.1%; P = .746), vomiting (16% vs 3.8%; P < .001), mucositis (7.3% vs 2.5%; P = .069). The most common grade 3 or 4 AEs in the respective arms were neutropenia (38.7% vs 26.4%; P = .280), asthenia (6.6% vs 0.6%; P = .019), febrile neutropenia (4% vs 1.3%; P = .168), thrombocytopenia (2.7% vs 1.3%; P = .439), diarrhea (2.7% vs 0% P = .057), nausea (1.3% vs 0%; P = .238), hepatotoxicity (0.7% vs 0.6%; P = 1.000), and vomiting (0.7% vs 0%; P = .487).

    Disclosures: All authors have declared no conflicts of interest.

    Reference

    Gavrilova D, Besova N, Obarevich E, et al. IRIGA: Phase III randomized trial of mFOLFIRINOX versus mFOLFOX6 as first-line treatment for HER2-negative metastatic gastric and gastroesophageal adenocarcinoma. Presented at: 2025 ESMO Gastrointestinal Cancers Congress; July 2-5, 2025; Barcelona, Spain. Abstract 391MO.

    Continue Reading

  • Air India Express Ignored Directive Ordering Airbus A320 Engine Part Change & Falsified Records

    Air India Express Ignored Directive Ordering Airbus A320 Engine Part Change & Falsified Records

    Air India Express reportedly ignored a directive from the European Union Aviation Safety Agency (EASA) to replace engine parts on its Airbus A320 aircraft and falsified documents to show compliance, according to a report by Reuters. The issue was raised in March 2025, several months before Air India’s fatal Boeing 787-8 Dreamliner crash.

    In response, India’s aviation regulator, the DGCA, reprimanded Air India’s budget carrier, according to a confidential government memo reviewed by Reuters. Following the report, Air India Express told the publication it had acknowledged the error to the regulator and taken “remedial action and preventive measures.”

    Modifications Were Required On VT-ATD

    Photo: Kowshi .L | Shutterstock

    In 2023, EASA issued Airworthiness Directive 2023-0108 for CFM International LEAP-1A engines, requiring the replacement of specific components. The directive was based on a manufacturer’s investigation that found some parts, including high-pressure turbine (HPT) stage 1 disks, forward outer seals, and compressor rotor stages 6–10 spools, may have been made from material with reduced strength due to iron contamination.

    The confidential memo from the Indian government, sent to the budget airline in March 2025 and reviewed by Reuters, stated that DGCA surveillance found the required engine modification on an Air India Express Airbus A320neo, registered as VT-ATD, had not been completed within the specified deadline. Adding to that, the memo said that “in order to show that the work has been carried out within the prescribed limits, the AMOS records have apparently been altered/forged.”

    The airline’s VT-ATD is a five-year-old narrowbody aircraft leased from AerCap. It has been flying in Air India Express livery since 2023, after previously being operated by AIX Connect (it merged with Air India Express in 2024), according to ch-aviation data. As of September 30, 2023, the aircraft has clocked in a total of 14,159 flight hours and 6,930 flight cycles.

    Air India Crash Prompts Scrutiny On Indian Aviation Safety

    Air India Boeing 787-8 at SIN shutterstock_2355149121

    Photo: Markus Mainka | Shutterstock

    Indian aviation safety came under intense scrutiny after the tragic crash of Air India’s Boeing 787-8 Dreamliner on June 12, 2025, which claimed 241 of the 242 lives on board. In the most recent news, India’s upper house of parliament has proposed a comprehensive safety review of the country’s civil aviation sector. Reuters reviewed a draft memo, which stated that airport operators, air traffic controllers, and airlines, including Air India and IndiGo, have been asked to participate in the review to improve safety standards.

    Additionally, Western aviation regulators in the United States, the United Kingdom, and France have reportedly raised concerns about the transparency of the Boeing 787 Dreamliner crash investigation being led by Indian authorities. According to two sources familiar with the matter, who spoke to Corriere della Sera, there are behind-the-scenes fears that local political pressures could influence the investigation and its final report.

    The concerns arose following the handling of the two black boxes, which were not sent to the United States or France, despite both countries’ recognized expertise in this area. Adding to this was the recent rejection of ICAO observers from participating in the investigation.

    Air India 787 Taxiing

    Related

    Aviation Safety Under Government Review Following Air India Crash

    Tomorrow will mark three weeks since an Air India Boeing 787 crashed in Ahmedabad.

    More About Air India Express

    Air India Express Boeing 737 MAX

    Photo: Air India Express

    Founded in 2005, Air India Express is a low-cost arm of Air India, which is owned by the Tata Group. The Tata Group officially took over Air India in 2022. The takeover raised hopes that Tata’s business acumen would help make Air India and its low-cost subsidiary Air India Express become “a world-class” carrier.

    The low-cost airline operates a fleet of 114 aircraft, according to ch-aviation. The fleet includes 49 Boeing 737 MAX 8s, 26 Boeing 737-800s, 24 Airbus A320-200s, 12 Airbus A320neos, and three Airbus A321neo narrowbodies. Looking ahead, the airline is awaiting deliveries of 50 Boeing 737 MAX 10s and 91 Boeing 737 MAX 8s, as per ch-aviation.


    Air India

    Year Founded

    1946

    CEO

    Campbell Wilson



    Air India Express operates flights to over 50 destinations, serving both international and domestic markets. Its route network spans across Asia-Pacific, the Middle East, and various cities within India.

    Continue Reading

  • [18F]AIF-NOTA-PCP2 Shows PD-L1 Monitoring Potential in Head and Neck Cancer

    [18F]AIF-NOTA-PCP2 Shows PD-L1 Monitoring Potential in Head and Neck Cancer

    [18F]AIF-NOTA-PCP2 uptake changes reflected therapeutic response to pembrolizumab (Keytruda) plus chemotherapy in a small cohort of patients with PD-L1–positive head and neck squamous cell carcinoma (HNSCC).

    [18F]AIF-NOTA-PCP2 may be a safe and effective PET tracer for noninvasive PD-L1 evaluation in patients with head and neck cancers, according to results from a prospective trial (NCT06690216) presented at the 2025 Society of Nuclear Medicine and Molecular Imaging Annual Meeting.

    Results revealed that [18F]AIF-NOTA-PCP2 showed acceptable dosimetry among all patients with head and neck cancers (n = 24) assessed with the tool. Additionally, no tracer-related adverse effects were observed in the study. Regarding biodistribution, the highest uptake was noted in the spleen, with minimal off-target uptake in the liver and intestines, as well as low renal uptake.

    High PD-L1 expression, characterized as having a tumor positive score (TPS) of 20% or greater, was associated with a significantly higher maximum standardized uptake value (SUVmax) at 5.92 vs 2.39 in tumors with a TPS of less than 20% (P <.001). Additionally, a strong positive correlation was observed between SUVmax and PD-L1 TPS, with a Spearman’s rank correlation of 0.890 (P <.001); the SUVmean vs PD-L1 TPS rs was 0.837 (P <.001).

    Additionally, variation in uptake was observed based on anatomical site, with higher uptake observed in orbital fibrous, tonsil, and oropharynx tumors, and lower uptake observed in larynx and oral cavity lesions. Furthermore, nonsquamous histology was associated with a higher uptake than squamous histology, with respective SUVmaxof 6.22 vs 3.61 (P = .041). HPV positivity in the HNSCC was also associated with higher SUVmax; at 5.93 vs 2.25 (P = .007).

    [18F]AIF-NOTA-PCP2 uptake changes reflected therapeutic response to pembrolizumab (Keytruda) plus chemotherapy in a small cohort of patients with PD-L1–positive head and neck squamous cell carcinoma (HNSCC). Among 3 patients with HNSCC who responded to treatment with pembrolizumab and chemotherapy, PD-L1 downregulation was observed in all patients.

    Specifically, in 1 patient who experienced a complete response, a rapid decrease in SUVmax was observed, from 6.52 to 4.06, a 37.7% decrease 1 week following therapy. Among 2 patients who experienced a partial response, a significant decrease in SUVmax was observed following 3 cycles of study regimen, with 54.0% and 23.0% decreases in each patient, respectively.

    “[With] [18F]AIF-NOTA-PCP2 … uptake changes clearly reflected therapeutic response. Responders showed significant and early decreases in PD-L1 downregulation.” Yong Wang, MD, managing director of Shandong Cancer Hospital and Institute in Jinan, Shandong, China, said in an oral presentation of the data. “[By] contrast, nonresponders showed a stable or increased uptake, [showing] strong potential for [18F]AIF-NOTA-PCP2 [in] early, dynamic PD-L1 monitoring.”

    Patients with HNC who were immunotherapy-naive across diverse tumor subsites were assessed with the peptide-based PET tracer. The median age of enrolled patients was 59.5 years, 79.2% of patients were males, and 25% were HPV positive. A total of 24 patients underwent [18F]AIF-NOTA-PCP2 PET/CT scans,17 underwent paired [18F]FDG PET/CT scans, and a total of 5 patients underwent immunotherapy monitoring.

    Preclinical data showed that [18F]AIF-NOTA-PCP2 had an excellent profile, with a high PD-L1 affinity. The half-maximal inhibitory concentration (IC50) of the tracer was 24.7 nanomolars (nM). Additionally, selective targeting of PD-L1–positive tumors in xenograft models were observed in preclinical trials.

    A head-to-head comparison assessing [18F]FDG PET/CT scans showed limited concordance between the 2 tracers. A weak correlation was observed between each (P = .042), with many FDG-avid tumors showing low PCP2 uptake and vice versa.

    In conclusion, Wang noted that future perspectives should include validation in larger, multicenter cohorts of patients with head and neck cancer, applications of [18F]AIF-NOTA-PCP2 in other cancer types, and the development of standardized immune-PET response criteria.

    Reference

    Wang Y, Liu Z, Yu J, Hu M, et al. Can [18F]FDG-PET/CT predict PD-L1 expression in head and neck carcinoma? A head-to-head comparison with a novel PD-L1 PET tracer. Presented at: 2025 Society for Nuclear Medicine and Medical Imaging Meeting; June 21-24, 2025; New Orleans, LA.

    Continue Reading

  • Landiolol bolus application for tachycardic dysrhythmia in the prehospital EMS setting – An observational study of a novel concept | Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine

    Landiolol bolus application for tachycardic dysrhythmia in the prehospital EMS setting – An observational study of a novel concept | Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine

  • Roth GA, Mensah GA, Johnson CO, Addolorato G, Ammirati E, Baddour LM, Barengo NC, Beaton AZ, Benjamin EJ, Benziger CP, et al. Global burden of cardiovascular diseases and risk factors, 1990–2019: update from the GBD 2019 study. J Am Coll Cardiol. 2020;76(25):2982–3021.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Kotadia ID, Williams SE, O’Neill M. Supraventricular tachycardia: an overview of diagnosis and management. Clin Med (Lond). 2020;20(1):43–7.

    Article 
    PubMed 

    Google Scholar 

  • Zeppenfeld K, Tfelt-Hansen J, de Riva M, Winkel BG, Behr ER, Blom NA, Charron P, Corrado D, Dagres N, de Chillou C, et al. 2022 ESC guidelines for the management of patients with ventricular arrhythmias and the prevention of sudden cardiac death: developed by the task force for the management of patients with ventricular arrhythmias and the prevention of sudden cardiac death of the European society of cardiology (ESC) endorsed by the association for European paediatric and congenital cardiology (AEPC). Eur Heart J. 2022;43(40):3997–4126.

    Article 
    PubMed 

    Google Scholar 

  • Sirichand S, Killu AM, Padmanabhan D, Hodge DO, Chamberlain AM, Brady PA, Kapa S, Noseworthy PA, Packer DL, Munger TM et al. Incidence of idiopathic ventricular arrhythmias: A Population-Based study. Circ Arrhythm Electrophysiol 2017;10(2).

  • Piccini JP, Schulte PJ, Pieper KS, Mehta RH, White HD, Van de Werf F, Ardissino D, Califf RM, Granger CB, Ohman EM, et al. Antiarrhythmic drug therapy for sustained ventricular arrhythmias complicating acute myocardial infarction*. Crit Care Med. 2011;39(1):78–83.

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Soar J, Böttiger BW, Carli P, Couper K, Deakin CD, Djärv T, Lott C, Olasveengen T, Paal P, Pellis T, et al. European resuscitation Council guidelines 2021: adult advanced life support. Resuscitation. 2021;161:115–51.

    Article 
    PubMed 

    Google Scholar 

  • Van Gelder IC, Rienstra M, Bunting KV, Casado-Arroyo R, Caso V, Crijns HJGM, De Potter TJR, Dwight J, Guasti L, Hanke T, et al.: 2024 ESC guidelines for the management of atrial fibrillation developed in collaboration with the European association for Cardio-Thoracic surgery (EACTS): developed by the task force for the management of atrial fibrillation of the European society of cardiology (ESC), with the special contribution of the European heart rhythm association (EHRA) of the ESC. Endorsed by the European stroke organisation (ESO). Eur Heart J. 2024;45(36):3314–414.

    Article 
    PubMed 

    Google Scholar 

  • Bedford JP, Johnson A, Redfern O, Gerry S, Doidge J, Harrison D, Rajappan K, Rowan K, Young JD, Mouncey P, et al. Comparative effectiveness of common treatments for new-onset atrial fibrillation within the ICU: accounting for physiological status. J Crit Care. 2022;67:149–56.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Walkey AJ, Evans SR, Winter MR, Benjamin EJ. Practice patterns and outcomes of treatments for atrial fibrillation during sepsis: A Propensity-Matched cohort study. Chest. 2016;149(1):74–83.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Balik M, Kolnikova I, Maly M, Waldauf P, Tavazzi G, Kristof J. Propafenone for supraventricular arrhythmias in septic shock—Comparison to Amiodarone and Metoprolol. J Crit Care. 2017;41:16–23.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Fatima N, Mandava K, Khatoon F, Badar J, Begum SF, Narasimhan C, Daljeet K, Mohammed W. CLInical profile and side effects of chronic use of oral Amiodarone in cardiology outpatients department (CLIPSE-A Study)- A prospective observational study. Annals Med Surg. 2022;80:104167.

    Article 

    Google Scholar 

  • Drikite L, Bedford JP, O’Bryan L, Petrinic T, Rajappan K, Doidge J, Harrison DA, Rowan KM, Mouncey PR, Young D, et al. Treatment strategies for new onset atrial fibrillation in patients treated on an intensive care unit: a systematic scoping review. Crit Care. 2021;25(1):257.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Medić F, Bakula M, Alfirević M, Bakula M, Mucić K, Marić N. AMIODARONE AND THYROID DYSFUNCTION. Acta Clin Croat. 2022;61(2):327–41.

    PubMed 
    PubMed Central 

    Google Scholar 

  • Ruzieh M, Moroi MK, Aboujamous NM, Ghahramani M, Naccarelli GV, Mandrola J, Foy AJ. Meta-Analysis comparing the relative risk of adverse events for Amiodarone versus placebo. Am J Cardiol. 2019;124(12):1889–93.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Brugada J, Katritsis DG, Arbelo E, Arribas F, Bax JJ, Blomström-Lundqvist C, Calkins H, Corrado D, Deftereos SG, Diller G-P, et al. 2019 ESC guidelines for the management of patients with supraventricular tachycardiathe task force for the management of patients with supraventricular tachycardia of the European society of cardiology (ESC): developed in collaboration with the association for European paediatric and congenital cardiology (AEPC). Eur Heart J. 2019;41(5):655–720.

    Article 

    Google Scholar 

  • Gorre F, Vandekerckhove H. Beta-blockers: focus on mechanism of action. Which beta-blocker, when and why? Acta Cardiol. 2010;65(5):565–70.

    Article 
    PubMed 

    Google Scholar 

  • Wong GWK, Boyda HN, Wright JM. Blood pressure Lowering efficacy of beta-1 selective beta blockers for primary hypertension. Cochrane Database Syst Reviews 2016;(3).

  • Gorczynski RJ, Shaffer JE, Lee RJ. Pharmacology of ASL-8052, a novel β-Adrenergic receptor antagonist with an ultrashort duration of action. J Cardiovasc Pharmacol. 1983;5(4):668–77.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Wiest D. Esmolol. A review of its therapeutic efficacy and Pharmacokinetic characteristics. Clin Pharmacokinet. 1995;28(3):190–202.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Iguchi S, Iwamura H, Nishizaki M, Hayashi A, Senokuchi K, Kobayashi K, Sakaki K, Hachiya K, Ichioka Y, Kawamura M. Development of a highly cardioselective ultra short-acting beta-blocker, ONO-1101. Chem Pharm Bull (Tokyo). 1992;40(6):1462–9.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Atarashi H, Kuruma A, Yashima M, Saitoh H, Ino T, Endoh Y, Hayakawa H. Pharmacokinetics of Landiolol hydrochloride, a new ultra-short-acting beta-blocker, in patients with cardiac arrhythmias. Clin Pharmacol Ther. 2000;68(2):143–50.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Krumpl G, Ulc I, Trebs M, Kadlecová P, Hodisch J. Pharmacokinetics and pharmacodynamics of two different Landiolol formulations in a healthy Caucasian group. Eur J Pharm Sci. 2016;92:64–73.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Iwahashi N, Takahashi H, Abe T, Okada K, Akiyama E, Matsuzawa Y, Konishi M, Maejima N, Hibi K, Kosuge M, et al. Urgent control of rapid atrial fibrillation by Landiolol in patients with acute decompensated heart failure with severely reduced ejection fraction. Circ Rep. 2019;1(10):422–30.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Schnaubelt S, Eibensteiner F, Oppenauer J, Tihanyi D, Neymayer M, Brock R, Kornfehl A, Veigl C, Al Jalali V, Anders S et al. Hemodynamic and rhythmologic effects of Push-Dose Landiolol in critical Care-A retrospective Cross-Sectional study. Pharmaceuticals (Basel) 2023;16(2).

  • Johnston BW, Chean CS, Duarte R, Hill R, Blackwood B, McAuley DF, Welters ID. Management of new onset atrial fibrillation in critically unwell adult patients: a systematic review and narrative synthesis. Br J Anaesth. 2022;128(5):759–71.

    Article 
    PubMed 

    Google Scholar 

  • Van Gelder IC, Hemels MEW. The progressive nature of atrial fibrillation: a rationale for early restoration and maintenance of sinus rhythm. EP Europace. 2006;8(11):943–9.

    Article 

    Google Scholar 

  • Gupta D, Rienstra M, van Gelder IC, Fauchier L. Atrial fibrillation: better symptom control with rate and rhythm management. Lancet Reg Health – Europe. 2024;37:100801.

    Article 
    PubMed 

    Google Scholar 

  • Levy B, Slama M, Lakbar I, Maizel J, Kato H, Leone M, Okada M. Landiolol for treatment of New-Onset atrial fibrillation in critical care: A systematic review. J Clin Med. 2024;13(10):2951.

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Krumpl G, Ulc I, Trebs M, Kadlecová P, Hodisch J. Bolus application of Landiolol and esmolol: comparison of the Pharmacokinetic and pharmacodynamic profiles in a healthy Caucasian group. Eur J Clin Pharmacol. 2017;73(4):417–28.

    Article 
    CAS 
    PubMed 

    Google Scholar 

  • Bucci T, Proietti R, Lip GYH. Risk of death and thromboembolic events in patients with supraventricular arrhythmias admitted to the emergency department. EP Europace 2024;. Volume 26, Issue Supplement_1, May 2024, euae102.833

  • Fornage LB, Christine ON, DS R, WE R, LR S, Brown LH. Prehospital intervention improves outcomes for patients presenting in atrial fibrillation with rapid ventricular response. Prehospital Emerg Care. 2024;28(7):910–9.

    Article 

    Google Scholar 

  • Nasoufidou A, Papazoglou AS, Stachteas P, Karagiannidis E, Samaras A, Alexiou S, Mourtzos MA, Kassimis G, Fragakis N. Intravenous Landiolol for rate control in supraventricular tachyarrhythmias in patients with left ventricular dysfunction: A systematic review and Meta-Analysis. J Clin Med 2024, 13(6).

  • Heliste M, Pettilä V, Berger D, Jakob SM, Wilkman E. Beta-blocker treatment in the critically ill: a systematic review and meta-analysis. Ann Med. 2022;54(1):1994–2010.

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Whitehouse T, Hossain A, Perkins GD, Gordon AC, Bion J, Young D, McAuley D, Singer M, Lord J, Gates S et al. Landiolol and Organ Failure in Patients With Septic Shock: The STRESS-L Randomized Clinical Trial. JAMA 2023.

  • Rehberg S, Frank S, Černý V, Cihlář R, Borgstedt R, Biancofiore G, Guarracino F, Schober A, Trimmel H, Pernerstorfer T, et al. Landiolol for heart rate control in patients with septic shock and persistent tachycardia. A multicenter randomized clinical trial (Landi-SEP). Intensive Care Med. 2024;50(10):1622–34.

    Article 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Schnaubelt S, Eibensteiner F, Sulzgruber P. Landiolol in septic Shock — No One-Size-Fits-All approach. Heart Lung Circulation. 2024;33(4):e31–2.

    Article 
    PubMed 

    Google Scholar 

  • Hariri G, Urbina T, Mazerand S, Bige N, Baudel JL, Ait-Oufella H. Rate control in atrial fibrillation using Landiolol is safe in critically ill Covid-19 patients. Crit Care. 2021;25(1):33.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Ditali V, Garatti L, Morici N, Villanova L, Colombo C, Oliva F, Sacco A. Effect of Landiolol in patients with tachyarrhythmias and acute decompensated heart failure (ADHF): a case series. ESC Heart Fail. 2022;9(1):766–70.

    Article 
    PubMed 

    Google Scholar 

  • Novotny J, Klein MM, Haum M, Fichtner SR, Thienel MB. Prevalence of pathological arrhythmia in patients triaged to cardiac arrhythmia in the emergency department: a preliminary study. Int J Emerg Med. 2022;15(1):49.

    Article 
    PubMed 
    PubMed Central 

    Google Scholar 

  • Smith G, McD Taylor D, Morgans A, Cameron P. Prehospital management of supraventricular tachycardia in victoria, australia: epidemiology and effectiveness of therapies. Emerg Med Australasia. 2014;26(4):350–5.

    Article 

    Google Scholar 

  • Fornage LB, O’Neil C, Dowker SR, Wanta ER, Lewis RS, Brown LH. Prehospital intervention improves outcomes for patients presenting in atrial fibrillation with rapid ventricular response. Prehospital Emerg Care. 2024;28(7):910–9.

    Article 

    Google Scholar 

  • Berkenbush M, Sherman N, Jain N, Cosmi P. Prehospital treatment of atrial fibrillation: infusion pump for bolus and infusion? Prehospital Emerg Care:1–4.2025;29(1):85-88. https://doi.org/10.1080/10903127.2024.2349745. Epub 2024 May 21.

  • Ball J, Mahony E, Nehme E, Voskoboinik A, Hogarty J, Dawson LP, Horrigan M, Kaye DM, Stub D, Nehme Z. The burden of atrial fibrillation on emergency medical services: A population-based cohort study. Int J Cardiol. 2024;414:132397.

    Article 
    PubMed 

    Google Scholar 

  • Vásquez-Tirado GA, Quispe-Castañeda CV, Meregildo-Rodríguez ED, Cuadra-Campos M, Segura-Plasencia NM, Arbayza-Avalos YK, Alva-Guarniz HN, Guzmán-Aguilar WM, Zavaleta-Alaya P. Association of beta blockers and mortality in adults with septic shock: systematic review and meta-analysis of randomized clinical trial. Front Med 2024;Sep 24:11:1448573; eCollection 2024.

Continue Reading

  • Hsp47 drives obesity-associated breast cancer progression by enhancing asporin deposition in adipose tissue | Breast Cancer Research

    Hsp47 drives obesity-associated breast cancer progression by enhancing asporin deposition in adipose tissue | Breast Cancer Research

    Transgenic mice

    We generated adipocyte-specific knockout Hsp47 mice by crossing Hsp47 Loxp/Loxp mice with Adipoq-cre mice (Jackson Lab, 010803). Asporin knock-out mice are from Dr. Paula Hurley at Vanderbilt University. Tail tip samples were collected for DNA isolation and genotyping PCR between 14 and 21 days after born. Genotyping PCR was performed using the 2X Mater Mixer and primers listed in the Supplemental Table. Female C57BL/6 mice, or Hsp47 adipocyte-specifically knockout (Hsp47 Adi-KO) or asporin KO female litter mates were randomly mixed and grouped for the xenograft experiments. All the mice were housed under 12/12 light/darkness cycles with free access to diet and water in the Division of Laboratory Animal Resources at the University of Kentucky. All procedures were performed with Division of Laboratory Animal Resources guidelines at the University of Kentucky.

    Human and mouse cell lines and cell line classification

    The human breast cancer cell lines MDA-MB 231 and human embryonic kidney cell line HEK293T were obtained from American Type Culture Collection (ATCC). Mouse breast cancer cell lines EO771 was obtained from ATCC. MDA-MB 231 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM)/F12 (Sigma Aldrich, D8437) with 10% fetal bovine serum (FBS) (Sigma Aldrich, F2442), 10 units/ml of penicillin and 0.1 mg/ml of streptomycin (Sigma, P4333). HEK293 FT cells were maintained in DMEM (Sigma Aldrich, D6429) with 10% FBS (Sigma Aldrich), 10 units/ml of penicillin, and 0.1 mg/ml of streptomycin (Invitrogen). EO771 cells were maintained in RPMI-1640 (Sigma Aldrich, R8758) with 10% FBS (Sigma Aldrich), 10 mM HEPES, 10 units/ml of penicillin, and 0.1 mg/ml of streptomycin (Invitrogen). Mouse 3T3-L1 cells were maintained in DMEM (Sigma Aldrich) with 10% Newborn calf serum (NCS) (Sigma, N4762), 10 units/ml of penicillin, and 0.1 mg/ml of streptomycin (Invitrogen). All the cells were cultured at 5% CO2 and 95% O2 at 37 °C. All cells were treated with Plasmocin™ (Invivo Gen, ant-mpt-1) to eliminate and prevent mycoplasma contamination.

    Kaplan-meier survival analysis and association analysis

    To address the clinical relevance of enhanced Asporin expression, we assessed the association between asporin mRNA levels and TNBC patient survival using Breast Cancer Gene-Expression Miner with multiple published datasets [24]. Tumor samples were equally grouped into low and high asporin expression based on the mRNA levels. The Cox proportional hazard (log-rank) test assessed significant differences in recurrent-free survival ratio. The correlation between Hsp47 expression and asporin was analyzed using the public microarray dataset generated from human breast cancer tissues.

    DNA constructs, transfection, and viral transduction

    SERPINH1 cDNA was cloned into pCDH1 plasmid and generated expression vector pCDH1-Hsp47 [23]. Flag-tagged mouse asporin full cDNA and truncated asporin cDNA (Mutant 1, Mutant 2) were sub-cloned from pCMV3-Asporin-FLAG (Sino Biological, Supplemental Table) into pCDH1 plasmid and generated expression vector pCDH1-Asporin (WT)-Flag, pCDH1-Asporin (MT1)-Flag and pCDH1-Asporin (MT2)-Flag. Mouse SERPINH1 Knockdown plasmids shHsp47 (Target Sequence: CGAACACTCCAAGATCAACTT, TRCN0000008532) were purchased from Sigma. HEK293 cells were transfected with pCDH1-Hsp47 and pCDH1-Asporin (WT)-Flag/pCDH1-Asporin (MT1)-Flag/pCDH1-Asporin (MT2)-Flag using FuGENE® HD Transfection Reagent (Promega, E2312). Cell lysis was collected for immunoprecipitation assay 48 h after transfection.

    Immunoblotting analysis

    Total tissue protein was isolated from adipocyte tissue using Minute™ Total Protein Extraction Kit (Invent, AT-022). Deposited ECM protein was isolated from culture cells using Compartment Protein Extraction Kit (Sigma, 2145). Culture cells were lysed in 2% SDS in PBS buffer containing phosphatase and protease inhibitor cocktails (EMD Millipore, 539131). Conditioned medium was collected at 24 h after being replaced with plan medium and precipitated by Acetone. Protein concentration was measured using Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, 23225). Equal amounts of protein lysates or cell conditional medium (normalized to cell numbers) were subjected to SDS gel electrophoresis, immunoblotted with primary antibodies at 4 °C overnight, and DyLight 680/800-conjugated secondary antibodies for 2 h at room temperature. The secondary antibodies used in the study were: DyLight 680 conjugated goat anti-rabbit IgG secondary antibody (Thermo Fisher Scientific, 35569), DyLight 800 conjugated goat anti-mouse IgG secondary antibody (Thermo Fisher Scientific, SA5-35521), DyLight 680 conjugated donkey anti-goat IgG secondary antibody (Thermo Fisher Scientific, SA5-10090). The primary antibodies used in this study were listed in Supplemental Table.

    Reverse transcription-polymerase chain reaction (RT-PCR)

    Total RNA was extracted from adipocyte tissue of control or Hsp47 Adi-KO mice using TRIzol reagent (Invitrogen, 15-596-018). cDNA was synthesized using the SuperScript™ III First-Strand Synthesis System (Invitrogen, 18-080-051) from 1.0 µg RNA samples. RT-PCRs were performed using Taq DNA polymerase on the C1000 Touch Thermo Cycler (Bio-Rad). Thermal cycling was conducted at 95 °C for 60 s, followed by 40 cycles of amplification at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 15 s. PCR products were performed agarose gel electrophoresis using 2% Agarose in TAE buffer (40 mM Tris-acetate, 1 mM EDTA). Information of primers used for amplification SERPINH1, β-Tubulin, and 18 S rRNA is in Supplemental Table.

    Special diet feeding

    3-week old males and females carrying different genotypes (Adipo-Cre/HSP47Loxp/Loxp, Adipo-Cre/HSP47Loxp/+, Adipo-Cre/HSP47+/+) were fed with a low-fat diet (LFD, 10 kcal% fat, Research Diets, D12450B) or high-fat diet (HFD, 60 kcal% fat, Research Diets, D12492). This special diet was renewed every week, and the changes in food weight were weighed for measuring the food intake of the mice. The body weights of mice with LFD were measured every week during the 12-week feeding period, and the body weights of mice with HFD were measured every week during the 20-week feeding period.

    Glucose measurement and glucose tolerance tests

    HFD-fed mice with different genotypes fasted for 6 h in the morning for glucose measurements. The tail vein was lanced with the lancet and a drop of blood from the tail was read as the baseline glucose level. For the glucose tolerance test, 6 h fasted mice were intraperitoneally injected with Glucose (2 g/kg body weight, 10 ml/kg volume). Blood glucose was measured at 15 min, 30 min, 60 min, 90 min, and 120 min after injection.

    Serum insulin measurement

    HFD-fed mice with different genotypes fasted for 6 h in the morning for insulin level measure. The tail vein was lanced with the lancet. Round 50 µl blood sample was collected and centrifuged for at least 15 min at 2200–2500 RPM within one hour of collection. Then the serum was transferred to new EP tubes for insulin levels measurement by the Mouse Ultrasensitive Insulin ELISA kit (ALPCO, 80-INSMSU-E01).

    Calorimetry experiments

    HFD-fed mice with different genotypes were examined the energy expenditure and energy balance via the TSE calorimetry chambers and the EchoMRI. Calorimetry will be performed according to the SOP as described in the 2016–2337 Protocol for The Center of Research in Obesity and Cardiovascular Diseases (COCVD) Mouse Metabolism Core of the University of Kentucky.

    Xenograft studies

    Control, Hsp47 Adi-KO and Asporin KO female mice were weaned at three-week-old and fed with HFD for twelve weeks. The wnt tumor tissue was harvested from mice and digested with collagenase, and the tumor organoids were collected for xenograft experiments. Mice were randomly grouped and injected with 1 × 105 EO771 cells or Wnt organoids at the 4th mammary fat pad. Tumors were measured with a caliper every 2 days to analyze tumor growth. At the experimental endpoint, tumors were harvested and fixed with a 10% Formalin solution for the paraffin-embedded section or frozen in OCT.

    Five-week-old female C57BL/6 mice were fed with HFD for four weeks and randomly grouped and daily injected with vehicle control or 10 mg/kg Col003 by intraperitoneal injection for eight weeks. Mice were injected with 1 × 105 EO771 cells at the 4th mammary fat pad. Tumors were measured with a caliper every 2 days and when tumors reached 60 ~ 70 mm3, mice were treated with vehicle control or 10 mg/kg Col003 daily. At the experimental endpoint, tumors were harvested and fixed with a 10% Formalin solution for the paraffin-embedded section or frozen in OCT for SHG imaging.

    Second harmonic generation (SHG) imaging

    SHG images were collected for adipose and tumor tissue sections through a Zeiss 20× water-dipping objective at 880 nm excitation. A cube filter set containing emission filters SHG (425 nm) was used in on the Zeiss 880 multiphoton microscope equipped with an Insight X3 extended wavelength laser (Spectra Physics, Santa Clara, CA, United States). Images were quantified with ImageJ.

    Masson’s trichrome staining

    Masson’s trichrome staining was performed following the manufacturer’s protocol (Polysciences, 25088). Mammary gland sections from 8-week-old control or Hsp47 Adi-KO female mice were deparaffinized and rehydrated through 100% alcohol, 95% alcohol, and 70% alcohol to water. Samples were re-fixed in Bouin’s solution at 60 °C for 60 min, stained in Weigert’s working hematoxylin for 10 min, and then stained in Biebrich scarlet-acid fuchsin solution for 5 min. Sections were incubated in phosphomolybdic/phosphotungstic acid solution for 10 min, and then were transferred to an aniline blue solution and incubated for 5 min. Then sections were incubated with 1% acetic acid for 1 min and washed in distilled water. Images were taken with a Nikon Eclipse 80i microscope.

    Immunohistochemical staining and H&E staining

    Xenograft tumor sections were deparaffinized and rehydrated through 100% alcohol, 95% alcohol, and 70% alcohol to PBS solution. Endogenous peroxidase was blocked by incubation with 3% H2O2 for 20 min. At the antigen retrieval step, slides were steamed in citrate sodium buffer for 30 min. Slides were blocked with Avidin/Biotin Blocking Kit (Vector Laboratories, SP-2001) and 5% goat serum, incubated with primary antibodies (anti-Hsp47, anti-Ki67, anti-Active Caspase 3, anti-F4/80, Supplemental Table) at 4 °C overnight, and then the sections were incubated with Biotinylated Goat Anti-Mouse IgG Antibody (Vector Laboratories, BA-9200) or Biotinylated Goat Anti-Rabbit IgG Antibody (Vector Laboratories, BA-1000) at room temperature for 60 min. After incubated with Streptavidin, Horseradish Peroxidase (Vector Laboratories, SA-5704) at room temperature for 30 min, staining signaling was accomplished after incubated with substrate diaminobenzidine (DAB, Vector Laboratories, SK-4100) and counterstained with hematoxylin. Images were taken with Nikon Eclipse 80i microscope.

    Adipocyte differentiation induction

    3T3-L1 Cells were seeded in a 6-well plate at a density of 6 × 105 cells/well as described in published paper [25]. After 24 h, the culture medium was renewed when cells reached 100% confluence. After 48 h, cell differentiation was induced by changing the medium to differentiation medium I: DMEM containing 10% FBS, 10 units/ml of penicillin, and 0.1 mg/ml of streptomycin, 0.5 mM IBMX, 0.25 µM dexamethasone, and 1 µg/ml insulin, 2 µM rosiglitazone. After 48 h, the medium was changed to differentiation medium II: DMEM containing 10% FBS, 10 units/ml of penicillin and 0.1 mg/ml of streptomycin, and 1 µg/ml insulin. After 48 h, the medium was changed to DMEM containing 10% FBS and 10 units/ml of penicillin and 0.1 mg/ml of streptomycin.

    Flow cytometry analysis

    To analyze adipocyte tissue infiltrated macrophage (Adipocyte tissue macrophages, ATMs), macrophage markers expression in adipocyte tissues were examined by flow cytometry analysis. Immune cells were isolated from adipocyte tissue as previously described [26]. In general, subcutaneous white adipocyte tissues (WAT) were collected from HFD-fed mice and digested by collagenase II digest solution. Stromal vascular cells were incubated with Fc-block (anti-CD16/32) and stained with cell surface markers (Supplemental Table) for 30 min at 4 °C protected from light to identify ATMs. For controls, additional stromal vascular cells are stained with each antibody individually (single stained controls) and the antibody cocktail minus one antibody, fluorescence minus one (FMO controls). Single stained controls and FMO controls were used to set up the compensation matrix and sorting gates. Add an additional 400 ul PBS and kept on ice for FACS analysis. FACS analysis was done with Becton Dickinson LSR II and data were analyzed by FlowJo software.

    Decellularization and ex vivo implantation

    Adult female mammary gland tissues were collected and sliced into 1–2 mm thick pieces, then placed in a sterile 6-well plate and incubated in rinse solution (deionized water with 5x penicillin/streptomycin) for 1 h at 4 °C [27]. Mammary gland tissues were removed from the rinse solution and incubated in 4% sodium deoxycholate (SDC solution) with 1x Pen/Srep for 24 h (change after 12 h) at room temperature to lyse cells. After rinsing 5 times with rinse solution for 1 h, mammary gland tissues were incubated in 8 mM 3-((3-cholamidopropyl)-dimethylammonium)-1-propanesulfonate (CHAPS solution) for 24 h (change after 12 h). Following rinsing 5 times with rinse solution, tissues were incubated in DNase solution (DNase 100 U/mL, with 5 × penicillin/streptomycin) 2 h at room temperature to lyse DNA. Mammary gland tissues were incubated with isopropanol for 24 h (change after 12 h, 4 °C), and then washed with rinse solution (20 min, three times) and stored at − 80 °C. Decellularized mammary gland tissue was cut into 5 mm square cubes and placed in a p-HEMA-coated 24-well plate. 0.2 × 106 MDA-MB 231-Luc cells were seeded on the top of the decellularized mammary gland tissue and incubated at 37 °C, 5% CO2 for 2 h to allow cells to attach. DMEM/F12 medium (1×B27, 20 ng/ml bFGF, 20 ng/ml EGF, 0.5 µg/ml hydrocodison, 5 µg/ml Insulin, 100 µg/ml Gentamicin (Life Technologies, Grand Island, NY, USA)) was carefully added to each well and incubated at 37 °C, 5% CO2 for the desired time. Luminescent intensity of MDA-MB 231-Luc cells attached and grew in the decellularized mammary tissue was measured using an in vivo imaging system (IVIS) on day 5 after seeding.

    IF staining

    Frozen tissue sections were fixed with 4% paraformaldehyde and permeabilized with 0.5% Triton X-100 for 20 min. After being blocked with 10% goat serum at room temperature for 60 min, tissue sections were incubated overnight with primary antibody (anti-Collagen IV) at 4 °C. After being washed three times, tissue sections were incubated in the dark with fluorescent conjugated secondary antibody for 1 h at room temperature. Stained samples were covered with DAPI-containing anti-fade mounting media (Vector labs, H1200-10) and imaged with a Nikon upright epi fluorescence microscope.

    ECM extraction and mass spectrometry analysis

    To enrich the ECM proteins of adipocyte tissues, we isolated ECM proteins from adipocyte tissues using the Compartment Protein Extraction Kit (Sigma, 2145) [28]. In general, WAT(100 mg) from mouse mammary glands were homogenized in 500 µl of Buffer C containing protease inhibitors using a tissue homogenizer until the tissue is completely disrupted. After sequential extraction of intracellular soluble proteins (cytosolic proteins, nuclear proteins, membrane proteins, the cytoskeletal proteins), the ECM-enriched pellets were suspended by adding the appropriate volume of 8 M urea with 10mM DTT. The ECM-enriched samples were alkylated by iodoacetamide, deglycosylated by PNGaseF, as well as digestion by Lys-C and trypsin. The digested samples were quenched with formic acid, concentrated and desalted with Ziptip before injected for MS analysis with a 150 min gradient adapted from literature. MS datasets were searched with Proteome Discoverer (Thermo Scientific) and Mascot version 1.3 (Matrix Science). Mascot search parameters were 10 ppm mass tolerance for precursor ions and 0.8 Da for fragment ions; two missed cleavages of trypsin with dynamic modifications including carbamidomethylation of cdegested ysteine, oxidized methionine, deamidation of asparagine, pyro-glutamic acid modification at N-terminal glutamine, and hydroxylation of lysine and proline.

    Immunoprecipitation assay

    Hsp47 expression plasmid pCDH1-Hsp47 and asporin expression plasmid CDH1-Asporin (WT)-Flag/pCDH1-Asporin (MT1)-Flag/pCDH1-Asporin (MT2)-Flag transfected HEK293 cells were lysed with ice cold hypotonic gentle lysis buffer (10 mM Tris-HCl [pH 7.5], 10 mM NaCl, 2mMEDTA, 0.5% Triton X-100, phosphatase and protease inhibitor cocktails (EMD Millipore, 539131) and incubated on ice for 10 min. 5 M NaCl was added in the cell lysis to 150mM concentration. The protein complexes were pulled down with anti-Flag M2 affinity gel (Sigma Aldrich, A2220), and the immunoprecipitated protein was eluted for immunoblotting analysis.

    DSP experiments

    Formalin-fixed paraffin embedded tissue sections were analyzed using Nanostring’s GeoMx Digital Spatial Profiling platform. All steps were carried out per Nanostring’s demonstrated protocol following manufacturer’s instructions. Slides underwent deparaffinization and antigen retrieval, followed by overnight incubation with Mouse Immune Cell Profiling Protein Core (Nanostring #GMX-PROCO-NCT-MICP-12), as well as anti-pan cytokeratin-AF532 and anti-CD45-AF594 (Nanostring #GMX-PRO-MORPH-MST-12) to visualize tissue sections and aid in region of interest selection. After incubation, slides were post-fixed, and nuclei were stained with Syto 13 before loading slides on the GeoMx instrument for whole slide fluorescent imaging. Regions of interest were selected from each sample and the nucleotide barcodes for panel antibodies bound in the region of interest were cleaved via UV exposure, then aspirated and transferred to a 96 well plate. The sample plate was processed per manufacturer’s instructions and analyzed on the Nanostring Sprint platform. The raw DSP data was normalized by the expression of the housekeeping protein Histone H3 within each ROI, then log2-transformed for downstream statistical analysis. Protein expression profiles of Hsp47 KO vs. Hsp47 pos groups within the tumor-adjacent (T-A) adipose tissue were visualized by heatmap. The linear mixed model with a fixed effect on Hsp47 genotype and a random intercept was applied to compare the Hsp47 KO vs. Hsp47 pos subgroups. The log2-fold change and p-value estimated from the linear mixed model were used to generate volcano plots within tumor and T-A adipose tissues, respectively, where the dots in red represent the proteins with p-value less than 0.05. Boxplots of proteins of interests were generated to manifest the direction of change between the Hsp47 KO vs. Hsp47 pos subgroups.

    Quantification and statistical analysis

    All experiments were repeated at least three times. Results were reported as mean ± standard error of the mean (S.E.M), the significance of difference was assessed by independent Student’s t-test or one-way analysis of variance (ANOVA) with SigmaPlot (Systat Software) or SPSS Statistics (IBM, Statistics). P < 0.05 is considered statistical significance, and P < 0.01 represented sufficient statistical significance. All reported P values were from 2-tailed tests.

    Continue Reading

  • THEM6 modulates carboplatin sensitivity by regulating ferroptosis through FDFT1 in triple-negative breast cancer | Breast Cancer Research

    THEM6 modulates carboplatin sensitivity by regulating ferroptosis through FDFT1 in triple-negative breast cancer | Breast Cancer Research

    TNBC tissue specimen

    The study protocol and tissue specimen acquisition were approved by the Ethical Review Committee of Xiangya Hospital (2024121786). From 2024 to 2025, four pairs of samples from patients with histologically confirmed primary triple-negative breast cancer (TNBC) who underwent core needle biopsies at Xiangya Hospital (Hunan, China), received neoadjuvant chemotherapy with carboplatin and paclitaxel for the first time, and subsequently underwent surgery, without prior targeted or immunotherapy, were included in this study. Paraffin-embedded TNBC samples were collected for mass spectrometry analysis, with pre-treatment tissues obtained from core needle biopsies before NAT and post-treatment tissues from surgical resections. Ultimately, Eight TNBC tissue specimens were subjected to 4D-label free proteome analysis (Majorbio, China). To validate our findings, we further utilized paraffin-embedded primary triple-negative breast cancer (TNBC) surgical samples from 44 cases collected between 2023 and 2025. These samples were from patients who received neoadjuvant chemotherapy with carboplatin and paclitaxel for the first time, without prior targeted or immunotherapy, and underwent immunohistochemical analysis to investigate the relationship between THEM6 expression and prognosis. Tumor response to treatment was evaluated using RECIST 1.1, categorizing patients into responder (S) and non-responder (NS) groups. Additionally, human TNBC tissue arrays (WZ-TNBC1201) were purchased from Shanghai Outdo Biotech Co., Ltd.

    Mass spectrometry

    Paraffin-embedded samples were deparaffinized by incubating them in xylene at 37 °C with constant shaking, followed by centrifugation at 14,000 g to remove residual paraffin. This process was repeated until no wax remained. The samples were then sequentially rehydrated with ethanol and ultrapure water. Following rehydration, lysis was performed using 5% SDT buffer (SDS, 100 mM Tris-HCl, pH 8.5) supplemented with a protease inhibitor cocktail, followed by three rounds of homogenization. Ultrasonic fragmentation was carried out for 1 h, and the lysates were subsequently heated in a boiling water bath at 95 °C for 60 min. After centrifugation, the supernatant was collected for protein quantification using a BCA assay. SDS-PAGE was performed to assess protein integrity. Protein digestion was conducted overnight in TEAB buffer (100 mM) using trypsin, following reduction with TCEP and alkylation with IAM. The resulting peptides were desalted using HLB cartridges, vacuum-dried, and quantified. Finally, data-independent acquisition (DIA) mass spectrometry was performed on a timsTOF Pro2 instrument in DIA-PASEF mode, acquiring MS data across an m/z range of 400–1200 with 64 isolation windows for comprehensive proteomic analysis. Proteins with significant differential expression were identified based on criteria of P < 0.05 and an absolute fold change > 2. The association between THEM6 expression and overall survival (OS) in TNBC patients was analyzed using the KM-Plotter online tool (http://kmplot.com) based on the GSE96058 dataset [13].

    Immunohistochemical staining

    The tissue sections were dehydrated, subjected to citrate antigen retrieval, and blocked with 5% goat serum for 15 min at room temperature. They were then incubated overnight at 4 °C with a diluted primary anti-THEM6 antibody. Following this, the sections were treated with DAB, counterstained with hematoxylin, and dehydrated using ethanol. Images were captured and analyzed using ImageScope software (Leica Microsystems). The histological score was calculated as Total score = Proportion score × Intensity score, and samples were classified as high or low expression based on a median score of 4.

    Cell lines and reagents

    The human triple-negative breast cancer cell lines MDA-MB-231 and BT-549 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) and RPMI 1640, respectively, each supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin. Cultures were maintained at 37 °C in a 5% CO2 atmosphere. Paclitaxel (HY-B0015) and Carboplatin (HY-17393) were obtained from MedChemExpress (MCE). The ferroptosis inhibitors ferrostatin (Fer-1, HY-100579) and liproxstatin-1 (Lip-1, HY-12726) were also purchased from MCE. Additionally, the pan-caspase inhibitor Z-VAD-FMK (HY-16658B), necrosis inhibitor necrostatin-1 (Nec-1, HY-15760), and autophagy inhibitor 3-methyladenine (3-MA, HY-19312) were sourced from MCE. Antibodies used in the study were acquired from the following suppliers: PGRMC1 (Zen-bio, 122868), THEM6 (Bioss, bs-15296R), FDFT1 (Proteintech, 13128-1-AP), GPX4 (Huabio, ET1706-45), SLC7A11 (Huabio, HA600098), ACSL4 (Huabio, ET7111-43), V5-tag antibody (Proteintech, 14440-1-AP), HA-tag antibody (Proteintech, 51064-2-AP), Flag-tag antibody (Proteintech, 20543-1-AP) and β-actin (Proteintech, 66009-1-Ig). lentiviral vectors including THEM6, PGRMC1 and the Negative Control, were purchased from GENERAL BIOL. Lentiviral particles containing shRNA targeting human FDFT1 (Locus ID 2222) were purchased from Origene.

    Lentiviral transduction

    Lentiviruses were packaged in HEK293T cells by co-transfection of the expression vector with packaging plasmids psPAX2 and pMD2.G using Lipofectamine 3000 (Invitrogen), following the manufacturer’s protocol. Viral supernatants were collected at 48 h post-transfection, filtered through a 0.45 μm membrane. Target cells (MDA-MB-231 or BT-549) were seeded in six-well plates and infected with lentivirus in the presence of 8 µg/mL polybrene. After 48 h, cells were selected with 2 µg/mL puromycin for one week. Stable expression was confirmed by Western blot analysis.

    Cell viability assay

    MDA-MB-231 and BT-549 cells were plated in 96-well plates at a density of 5 × 10^4 cells/ml. Following cell adherence, the cultures were treated with specified concentrations of carboplatin or paclitaxel for 48 h. Cell viability was evaluated using the Cell Counting Kit-8 (CCK-8) assay (MCE, HY-K0301), according to the manufacturer’s protocol. Absorbance at 450 nm was quantified using a microplate reader (PerkinElmer). The half-maximal inhibitory concentration (IC50) values were determined from dose-response curves generated using GraphPad Prism software.

    Colony formation assay

    Breast cancer cells were seeded into six-well plates and allowed to adhere overnight. They were then treated with 0, 0.5, or 1 µM carboplatin for 48 h. Following drug treatment, the medium was removed, and the cells were washed with PBS, trypsinized, and replated at a density of 2000 cells per well in new six-well plates. The cells were incubated for 14 days to allow colony formation. Colonies were subsequently stained with crystal violet, and the number of colonies in each condition was quantified.

    Live/dead viability assay

    Cells were seeded into 6-well plates at a density of 5 × 10^4 cells per well. After 48 h, cell viability was assessed using the Calcein AM/PI Live-Dead Cell Staining Kit I (APExBIO, K2247). Briefly, cells were incubated with 1 µM propidium iodide (PI) and 1 µM Calcein AM for 30 min at room temperature. Following staining, the cells were washed twice with PBS. Fluorescence microscopy was performed using an Axio Observer 3 fluorescence microscope (Carl Zeiss Microimaging) to visualize and differentiate live (green) and dead (red) cells.

    Quantitative real-time PCR

    Total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized with SuperScript™ II reverse transcriptase (Invitrogen), and quantitative PCR was performed using Power SYBR Green PCR Master Mix (Takara). The primers used for the SYBR Green assays were as follows: THEM6-F:5′-GCAGCACTGGATCTCCTACAACG-3′; THEM-R: 5′- GGTCCTTGGTGACATCACTGAGC-3′; FDFT1-F:5′-GCAACGCAGTGTGCATATTTT-3′; FDFT1-R: 5′-CGCCAGTCTGGTTGGTAAAGG-3′; β-actin-F: 5′-CACCATTGGCAATGAGCGGTTC-3′; and β-actin-R: 5′- AGGTCTTTGCGGATGTCCACGT − 3′. Real-time amplification was carried out using an ABI Prism 7000 SDS (Applied Biosystems). Gene expression levels were quantified using the 2−ΔΔCT method, with normalization to β-actin as the reference gene.

    Western blot and ubiquitination assays

    Cells were lysed using RIPA lysis buffer (MCE, HY-K1001) supplemented with a protease inhibitor cocktail (MCE, HY-K0010). The protein concentration in the cell lysate was determined using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, 23225), following the manufacturer’s protocol. Samples were then denatured with SDS-PAGE protein loading buffer (Beyotime, D0071) at 100 °C for 5 min. Proteins were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, ISEQ00010). After overnight incubation with the primary antibody, the membranes were probed with the secondary antibody at 37 °C for 1 h. Protein bands were visualized using Pierce™ ECL Western Blotting Substrate (Thermo Scientific, 32106) and captured using Image Lab software version 5.0 (Bio-Rad). For Ubiquitination assays, cells were lysed with 100 µL of NETN buffer (62.5 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol, 20 mM NEM, 1 mM iodoacetamide), boiled for 15 min, and then diluted 10-fold in NETN containing protease inhibitors, NEM, and iodoacetamide. After centrifugation, the supernatant was subjected to immunoprecipitation and analyzed by Western blotting [14].

    Cycloheximide (CHX) Chase assay

    To evaluate protein stability, MDA-MB-231 and BT-549 cells stably expressing either THEM6 or a negative control were seeded in six-well plates and cultured to approximately 70% confluence. CHX was added to the culture medium at a final concentration of 0.1 mg/mL. Cells were harvested at designated time points (0, 2, 4, 6, and 8 h) following CHX treatment. At each time point, cells were washed with ice-cold PBS and lysed in RIPA buffer supplemented with protease inhibitors. Lysates were clarified by centrifugation at 14,000 g for 15 min at 4 °C, and protein concentrations were quantified using a BCA assay. Equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis to assess protein degradation kinetics.

    ROS measurement

    Intracellular ROS levels were measured using the fluorescent probe 2′,7′-dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma, 35845). This probe diffuses into cells and is enzymatically converted to the fluorescent 2′,7′-dichlorofluorescein (DCF). Triple-negative breast cancer (TNBC) cells were plated at a density of 6 × 10^5 cells per well in 6-well plates and incubated for 24 h. The cells were then exposed to 5 µM carboplatin for 48 h. After treatment, the cells were incubated with 10 µM DCFH-DA solution at 37 °C for 30 min, followed by three washes with phosphate-buffered saline (PBS). DCF fluorescence was visualized using an Axio Observer fluorescence microscope (Carl Zeiss Microimaging) with excitation at 485 nm and emission at 535 nm.

    Ferrous iron measurement

    Intracellular ferrous iron (Fe²⁺) content was quantified using the Iron Assay Kit (Abcam, ab83366). Briefly, samples were incubated at 25 °C for 30 min, followed by an additional 60-minute incubation with the iron probe at 25 °C to form a stable colored complex. Standard curve and reaction solutions were prepared according to the manufacturer’s instructions. The samples were then transferred to a microplate reader (PerkinElmer), and Fe²⁺ levels were determined by measuring absorbance at 539 nm.

    Malondialdehyde measurement

    Malondialdehyde (MDA) levels were measured in the lysates using the Lipid Peroxidation Assay Kit (Beyotime, S0131) according to the kit’s instructions. Briefly, 0.1 mL sample was mixed with 0.2 mL of the MDA detection working solution and incubated for 15 min at 100 °C. The samples were then allowed to cool to room temperature and centrifuged at 1000 × g for 10 min to collect the supernatant. Next, 200 µL of the supernatant was transferred to a 96-well plate, and absorbance was measured at 532 nm using a microplate reader (PerkinElmer). MDA levels were expressed as the ratio of the absorbance value to that of the control group.

    Transmission electron microscope assay

    Briefly, cells were seeded in 6-well plates at a density of 5 × 10^4 cells per well and treated with or without 5 µM carboplatin for 48 h. After treatment, cells were collected, washed with PBS, and fixed with 2.5% glutaraldehyde. The samples were then processed according to standard procedures, and images were obtained using a transmission electron microscope (Hitachi). The proportion of mitochondria with increased bilayer membrane formation was quantified using TEM images. To determine the size of mitochondria, TEM images were analyzed using ImageJ software to measure the mitochondrial area, and the relative mitochondrial size was provided.

    Xenograft mouse model

    The experiments were conducted with approval from the Animal Care and Use Committee of Central South University (China) (XY20240903005). Control or THEM6-overexpressing MDA-MB-231 cells (2 × 10^6) were orthotopically implanted into the mammary fat pads of 20 BALB/c nude mice (4 weeks old). Once the tumors reached approximately 50 mm³ in size, the mice were randomly assigned to four groups, with 5 mice per group: a carboplatin treatment group, in which carboplatin was administered via intraperitoneal (IP) injections at a dose of 50 mg/kg once weekly for three cycles, and a control group. Tumor volumes were measured every 3 days using calipers from the start of treatment and calculated using the formula (length × width2) × 1/2. Mice were sacrificed for tumor dissection on day 35 post-treatment initiation. H₂O₂ levels were measured using an H₂O₂ assay kit (Beyotime). Tumor tissue was homogenized, and absorbance at 560 nm was measured using a microplate reader (PerkinElmer).

    Statistical analysis

    Overall survival (OS) was analyzed using Kaplan–Meier curves and compared with the log-rank test. Data are presented as mean ± SD (n ≥ 3) and were analyzed using GraphPad Prism 6 software (GraphPad Software). Differences between groups with continuous data were evaluated using the Student’s t-test. p-values less than 0.05 were considered statistically significant.

    Continue Reading

  • Metaverse-assisted teaching in occupational safety and health (MATOSH) programme and its effectiveness in improving interest, understanding, and engagement in the occupational health subject among generation Z medical Students – a design and development research | BMC Medical Education

    Metaverse-assisted teaching in occupational safety and health (MATOSH) programme and its effectiveness in improving interest, understanding, and engagement in the occupational health subject among generation Z medical Students – a design and development research | BMC Medical Education

    This study was conducted in three phases, in accordance with the Design and Development Research (DDR) framework [16]. Phase 1 (not described in this article) involved a need analysis via literature review to identify gaps in students’ learning interest, understanding, and engagement of the occupational health subject as well as the need of a novel programme. Phase 2 involved the design and development of a metaverse programme known as MATOSH. In Phase 3, the MATOSH programme was implemented among medical students to empirically evaluate its effectiveness in improving their interest, understanding, and engagement in the occupational health subject. The study flowchart is illustrated in Fig. 1 below.

    Fig. 1

    Flowchart of the Current Study

    Phase 2 (Design and Development)

    Phase 2 involved two components, which were the design and development of the MATOSH programme. This phase was conducted over a two-month period from June 2024 to July 2024.

    Study design, study location, and study population

    The content design of the MATOSH programme adopted a nominal group technique (NGT). Third-year medical students from the Faculty of Medicine at the National University of Malaysia served as the study population. This cohort was selected because the occupational health subject was introduced to them for the first time during the public health posting. Meanwhile, the development of MATOSH involved both academicians and third-year medical students from the same university, all of whom participated exclusively through online meetings.

    Sample size

    Fifteen third-year medical students and an occupational health lecturer from the Faculty of Medicine at the National University of Malaysia (UKM) were invited to the NGT to identify the top five important occupational health topics to be included in the MATOSH programme. The development of MATOSH involved three academicians (i.e., one occupational health and two computer science lecturers) and three third-year medical students.

    Sampling method

    The 15 medical students in NGT were recruited through purposive sampling. The sampling frame, consisting of a list of medical students, was obtained from the posting coordinator for the public health posting. Students (the sampling units) were selected based on the following inclusion criteria: (i) completion of the public health posting; (ii) attendance of at least 75% of the occupational health lectures (i.e., three out of four lectures); and (iii) access to a metaverse platform, regardless of prior experience with its use. However, students were excluded if they: (i) had recently failed the public health posting; or (ii) declined to provide informed consent for participation in the study. An experienced occupational health lecturer who currently teaching the subject at the same university was also invited to the NGT. For the development of MATOSH, the developer team (consisted of three academicians and three medical students) were recruited through purposive sampling method from the researchers’ network.

    Study instruments

    To determine and include the top five important occupational health topics for the content design of the MATOSH programme, an interview schedule was developed. It consisted of a central question of “what topics should be included in the MATOSH programme to effectively teach occupational health to medical students”. Meanwhile, to develop the MATOSH programme, a password secured laptop (Microsoft Surface Go with 16GB RAM) was utilised. Besides that, online software such as Spatial.io and Sketfab.com were used to design the virtual environment and virtual avatars, respectively. Both of these software were used under free account plans.

    Study procedure

    For the NGT (for MATOSH programme content design), 15 third-year medical students who met the inclusion criteria and an occupational health lecturer were invited to a meeting room at the faculty. As an introduction, the participants were brief regarding the aim of the NGT, which was to determine the top five important occupational health topics to be included in the MATOSH programme. Initially, participants engaged in silent idea generation, where they independently wrote down as many relevant occupational health topics as they could within 10 min. This was followed by a round-robin sharing session, where each participant took turns presenting one idea at a time. All ideas were recorded verbatim by the facilitator on a shared screen. This continued until all participants had contributed all their ideas. No discussion or evaluation occurred during this stage to ensure equal contribution from all participants. In the clarification and consolidation phase, the participants reviewed the compiled list of occupational health topics. Any overlapping or similar ideas were grouped or rephrased with the consensus of the participants. Participants could ask questions for clarification, but detailed debates were discouraged to maintain focus and efficiency. Next, during the voting and ranking phase, each participant was asked to provide scores for each occupational health topic based on importance (“1” = least important until “5” = most important). Rankings were submitted anonymously using Google form. In the final step, results were tallied, and the five topics with the highest percentages were identified and displayed. A group discussion followed to confirm consensus and ensure all participants were satisfied with the outcome. This process resulted in a ranked list of the top five important occupational health topics, which served as the foundation for content design of the MATOSH programme.

    Once the top five important occupational health topics were identified, the development of a metaverse programme began by following a structured seven-step process [17]. The first step involved defining the metaverse concept by aligning content with the existing occupational health subject, which included four lectures on occupational hazards, HIRARC, SOCSO roles, relevant legislation, and universal precautions in hospital. Content development was guided by consultations with one occupational health lecturer and two computer science lecturers. The second step established the technological requirements, which identify the necessary hardware and software components. MATOSH was developed using Spatial.io [18], a free web-based platform that supported metaverse creation without the need for advanced devices such as VR or AR goggles, and without requiring personal cloud storage, as all data resided on the platform itself. The third step focused on designing virtual entities and environments. The virtual space was modelled as a hospital using Spatial.io templates, while virtual three dimensional hospital staff were generated from Sketchfab.com [19]. The fourth step integrated social interaction dynamics to enhance student engagement. As such, students were able to customise avatars, navigate through the virtual hospital using “W””, “A”, “S”, “D” buttons, interact with other users, and dicuss occupational health scenarios virtually. The fifth step addressed the development of a virtual economy, in which MATOSH was decided as a non-profit educational tool with no commercial or NFT elements. The sixth step involved testing and optimisation through internal evaluation and feedback from three medical students, which allowed for improvements in usability and content. The final step was the launch and publication of MATOSH on Spatial.io, with access restricted to educational and research use, and no online promotional efforts.

    Statistical analysis

    In the NGT, the total scores for each occupational health topic were calculated and converted to percentages (i.e., total score of each topic divided by 75 and then convert to 100%), and the five occupational health topics with the highest percentages were selected. Descriptive statistics, including frequency counts and total scores, were used to summarise the ranking data. No inferential statistical tests were applied, as the purpose of the NGT was to reach group consensus rather than to test hypotheses.

    Phase 3 (Implementation and Evaluation)

    Phase 3 consisted of two components, namely the implementation and evaluation of the effectiveness of MATOSH in improving medical students’ interest, understanding, and engagement in the occupational health subject. This phase was conducted over a 9-month period, from August 2024 to April 2025.

    Study design, study location, and study population

    The implementation component of this phase of the study involved a cognitive debriefing to validate the MATOSH programme, while the evaluation component of the MATOSH programme employed a quasi-experimental design. Third-year medical students from the Faculty of Medicine at the National University of Malaysia served as the study population. This cohort was selected because they were introduced to the occupational health subject for the first time during the public health posting.

    Sample size Estimation

    Given the skill engagement score for students with conventional learning = 3.78 ± 0.55 points [20], skill engagement score for students with e-learning = 3.56 ± 0.81 points [20], significance level = 0.05, power of study = 80%, the required sample size was 208 students (i.e., 104 students for intervention and 104 students for control group). This was calculated using Pocock’s formula for two means. Although 208 students were recruited, 36 did not return their responses, resulted only 88 and 84 students in the intervention and control groups, respectively.

    Sampling method

    In Phase 3, medical students were recruited through purposive sampling. The sampling frame, which was the list of medical students, was obtained from the posting coordinator for the public health posting. Students (the sampling units) were selected based on the following inclusion criteria: (i) enrolment in the public health posting at the time of recruitment; (ii) attendance of at least 75% of the occupational health lectures (i.e., three out of four lectures); and (iii) access to a metaverse platform, regardless of prior experience with its use. Exclusion criteria included: (i) students who were repeating the public health posting at the time of recruitment; and (ii) students who declined to provide informed consent for participation in the study.

    Study instruments

    In the implementation component of Phase 3, a semi-structured interview schedule was developed for the cognitive debriefing. This interview schedule included six questions pertaining to the content clarity, content relevance, visual appearance, usability, education value, technical functionality.

    Meanwhile, in the evaluation component of Phase 3, three tools were utilised to evaluate the effectiveness of the MATOSH: the Study Interest Questionnaire (SIQ), Occupational Health End of Module (OH-EOM) test paper, and the Student Course Engagement Questionnaire (SCEQ). These instruments were employed to evaluate students’ interest, understanding, and engagement in the occupational health subject, respectively.

    The Study Interest Questionnaire (SIQ) is an 18-item, unidimensional questionnaire developed by Schiefele et al. in 1987 [21]. It was intended to measure students’ interest in a specific field of study, based on the Educational Interest Theory. The 18 items in the SIQ were ranked on a Likert scale from 1 (“not at all true”) to 4 (“completely true”), with scores ranging from 18 to 72 points. Higher total scores were associated with more interest in the student’s field of study. Items 1, 2, 5, 7, 9, 10, and 11 were reverse coded (see Appendix C). Cronbach’s alpha was 0.90 and test-retest reliability was 0.67 over a 2-year period. Convergent, discriminant, and concurrent validity of the SIQ was demonstrated by correlations between SIQ and intrinsic motivation (r = 0.46, p < 0.001), extraversion (r = 0.01, p > 0.05), and use of deep learning strategies (r = 0.45, p < 0.001). Students’ exam performance over 2 years correlated with SIQ scores as evidence of predictive validity (r = 0.33, p < 0.05).

    The Occupational Health End of Module (OH-EOM) test paper was created by the lecturers responsible for teaching the occupational health subject in the public health posting. This test was initially developed to assess students’ understanding of the occupational health subject at its conclusion. It comprised 10 multiple-choice questions (with options A to D), and students were required to select the best answer. Each correct response was awarded one mark, resulting in a total score range of 0 to 10. Higher marks indicated a higher level of understanding towards the occupational health subject. This test paper was vetted by two occupational health lecturers at the Department of Public Health Medicine, Faculty of Medicine, UKM.

    The Student Course Engagement Questionnaire (SCEQ) was developed by Handelsman in 2005 to assess engagement among university students [22]. It consisted of 23 items with four domains, including skills engagement (9 items), participation/interaction engagement (6 items), emotional engagement (5 items), and performance engagement (3 items) (Handelsman et al. 2005). Participants responded using a 5-point Likert scale (i.e., 1 = “much less like me” to 5 = “much more like me”) (see Appendix E). The total scores on the SCEQ ranged from 23 to 115. Although there was no specific cut-off point in this questionnaire, higher total scores indicated a higher level of engagement. The SCEQ demonstrated good internal consistency across the four engagement domains (Cronbach’s alpha ranged from 0.76 to 0.82). It also demonstrated good convergent validity, in which the SCEQ scores were significantly associated with absolute and relative engagements (β = 0.16–0.38).

    Study procedure

    For the implementation component of Phase 3, 15 third-year medical students who met the inclusion criteria (similar to those described in Phase 2) were invited to a lecture hall for cognitive debriefing. They were first requested to independently explore the MATOSH programme using their personal devices (e.g., smartphones, tablets or laptops). Following this, each student participated in a cognitive debriefing interview. The feedback obtained from these interviews informed essential modifications to enhance the design, functionality, and usability of the metaverse. All cognitive debriefing interviews were audio-recorded to serve as a reference for the research team.

    For the evaluation component of Phase 3, medical students who were assigned to the control group (n = 104) received only conventional lectures. Meanwhile, the medical students allocated to the intervention group (n = 104) received both conventional lectures and the MATOSH programme.

    For the control group, four occupational health lectures were conducted, with one lecture per week in a lecture hall. The four lectures covered the following topics: types of occupational hazards, HIRARC, the roles of SOCSO, occupational safety and health legislations, and universal precautions in hospital. At the conclusion of the posting, the researchers distributed the study instruments (SIQ, OH-EOM test paper, and SCEQ) for in-class assessment. Prior to participation, students were briefed on the research project and asked to complete an online informed consent form. Those who declined participation were instructed to remain seated quietly in the lecture hall. Medical students who consented to participate received three Google Forms, namely the SIQ, OH-EOM, and SCEQ. They were instructed to complete all tasks within 20 min without engaging in peer discussion.

    Medical students in the intervention group also attended four weekly occupational health lectures, covering the same topics as the control group: types of occupational hazards, HIRARC, the roles of SOCSO, occupational safety and health legislations, and universal precautions in hospital. Additionally, the intervention group had an extra session dedicated to introducing them to the MATOSH metaverse programme. During this fifth session, students received instructions on how to navigate the MATOSH platform and were given one hour to explore its content using their own mobile devices (e.g., smartphones, tablets or laptop). At the end of the posting, the researcher distributed the study instruments (SIQ, OH-EOM test paper, and SCEQ) for in-class assessment. Students were briefed on the research project and asked to complete an online informed consent form before participating. Those who chose not to participate were instructed to remain quietly in the lecture hall. Students who consented to participate received three Google Forms, namely the SIQ, OH-EOM, and SCEQ, and were asked to complete all tasks within 20 min, without engaging in peer discussion.

    Statistical analysis

    Qualitative data from the implementation component (cognitive debriefing) was analysed thematically using inductive coding. Meanwhile, in the evaluation component, descriptive analysis was conducted to outline the sociodemographic characteristics of the medical students who participated in the study. Continuous data were reported as mean and standard deviation if data were normally distributed, or as median and interquartile range if data were not normally distributed. Categorical data were presented as frequencies and percentages.

    Since all data was normally distributed (ascertained using Kolmogorov-Smirnov test), a paired t-test was conducted to assess any significant difference between pre- and post-intervention SIQ, OH-EOM, and SCEQ scores for both intervention and control groups (i.e., within group comparison). Meanwhile, an independent t-test was performed to assess the significant differences in the SIQ, OH-EOM, and SCEQ scores between the intervention and control groups (i.e., between groups comparison). A significance level of p < 0.05 was set. All statistical analyses were conducted using SPSS version 28.

    Ethical considerations

    The current study received ethical approval from the Ethics Committee of the National University of Malaysia (JEP-2025-219). Online information booklets outlining the study’s objectives and procedures were provided to the medical students via Google Forms. Online informed consent was obtained from the medical students prior to their participation. Medical students were not penalised if they refused to participate in the study. They were also taught with the same level of commitment and the same amount of academic content, regardless of their group allocation. The investigators adhered to the principles outlined in the Declaration of Helsinki as well as the Malaysian Good Clinical Practice Guidelines.

    No personal identifiers were captured in the Google Form. Only authorised research team members had access to the research data, and their access was monitored and restricted based on necessity. The collected data were securely stored in a password-protected, encrypted online database hosted on a secured server. Study data were retained for a period of five years following the publication of the study results. At the end of the five-year retention period, all study data were permanently deleted or destroyed.

    Continue Reading

  • Innovations in neurosurgical education: the role of neurosurgical labs at neuroscience hospital of Baghdad in enhancing surgical skills | BMC Medical Education

    Innovations in neurosurgical education: the role of neurosurgical labs at neuroscience hospital of Baghdad in enhancing surgical skills | BMC Medical Education

    The history of neurosurgery in Iraq is deeply rooted in ancient Mesopotamia, where early forms of surgical intervention, such as abscess drainage, were documented on cuneiform tablets​. The scientific structure of neurosurgery in Iraq took shape in the 1950s, with the first elective neurosurgical procedure being carried out by Dr. Najeeb Al-Yaaqubi and was further formalized in 1966 by Dr. Saad Al-Witry, considered the father of Iraqi neurosurgery. A milestone was passed when 1972 the Neurosurgery Teaching Hospital was inaugurated in Baghdad; this became a central focal point for neurosurgical training and practice [6]. The history of neurosurgery development took another course in the Kurdistan region of Iraq when international collaborations aimed at building local neurosurgical capacities in cities like Duhok started in 2012 [7].

    The research findings are useful in understanding the role of the neurosurgical virtual laboratory at Neuroscience Hospital, Baghdad (Figs. 3, 4 and 5). The neuroscience hospital at Baghdad uses a stepwise, competency-based educational model in the neurosurgical lab. This was mainly developed through simulation-based training on clinically relevant scenarios. Iterative practice further reinforces learning, whereby immediate feedback from mentors during the process provides participants with opportunities to refine techniques and decision-making. It provided a very excellent avenue of professional growth between mentors and mentees. The mentors then took the mentees through iterative learning cycles of providing personalized feedback and clinical insights that could help fine-tune surgical precision and decision-making. Teaching in the neurosurgical lab was led by experienced neurosurgeons and senior residents with specialized expertise in simulation-based training.

    Fig. 3

    Neurosurgical Training Facilities at Neuroscience Hospital, Baghdad. (A) Microscope stations and 3D training models used by residents for hands-on neurosurgical simulation and skill development. (B) A collection of photos showcasing collaborative workshops and innovation sessions between neurosurgery residents, faculty members, and international visitors, underscoring the importance of mentorship and skill sharing in the lab

    Fig. 4
    figure 4

    Advanced Neurosurgical Training Equipment at Neuroscience Hospital, Baghdad. (A) High-resolution microscopes used for neurosurgical simulations, enabling residents to practice precision techniques in a controlled environment. Anatomical posters and reference books support theoretical learning alongside practical skills. (B) Endoscopic training setup featuring a head model and monitor, simulating real-time surgical procedures for enhancing skills in minimally invasive neurosurgery

    Fig. 5
    figure 5

    Endoscopic and Microsurgical Simulation in Neurosurgical Training at Neuroscience Hospital, Baghdad. (A) Hands-on endoscopic training using a skull model, allowing residents to practice minimally invasive neurosurgical techniques. (B) Endoscopic view displaying the needed anatomy during a simulated procedure, enhancing visual-spatial understanding. (C) Microsurgical practice with high magnification, providing precision skill training in surgical anatomy and dissection. (D) Live demonstration of microsurgical techniques projected on a screen, used for educational purposes in ongoing resident workshops and seminars

    A considerable proportion of participants (70%) reported weekly lab use, indicating that the facility is integral to their training and practice. Moreover, overall satisfaction with the lab experience was high, with 60% rating their satisfaction as 4 and 40% rating it as 5. This suggests that the lab is meeting the expectations of its users across various levels of experience. Notably, the chi-square test revealed a statistically significant association between satisfaction and the frequency of lab use (p = 0.010), highlighting that those who use the lab more frequently are more likely to be satisfied with their experience. Interestingly, satisfaction was not significantly influenced by gender (p = 0.519), indicating that both male and female participants had comparable satisfaction levels. However, years of neurosurgical experience significantly affected satisfaction (p = 0.009), with participants having more than 15 years of experience showing the highest levels of satisfaction. The gender distribution was skewed toward male participants, reflecting the broader gender imbalance currently observed in the neurosurgical field in our region.

    The results demonstrate the high perceived educational value of various lab resources. The microscope and training models were consistently rated highly, with 40% of participants giving a maximum score of 5 for both tools. The impact of the 3D printers is rated lower: 20% gave a score of 5, and 40% gave a score of 4. This suggests variability in either utilization or perception of this resource. For medical textbooks, the rating was incredibly positive for 40% of the respondents.

    In the article about the surgical skills in neurosurgical residency training, Liu et al. [8] focused on the especially important role of neurosurgical residency training in the context of surgical skills laboratories. They sought to enhance residents’ technical skills in complex skull base operations through a cadaveric-based, structured dissection curriculum and modern equipment at Cleveland Clinic. Furthermore, three-dimensional printing has evolved to be a robust neurosurgical education and anatomy training tool. Thiong’o et al. (2021) [9] describe the role that 3D printing plays in neurosurgical simulation, including skull base surgery and vascular procedures, to practice complex surgical skills outside the operating theater. It has proved beneficial in decreasing the learning curve for difficult procedures. Also, Baskaran et al. (2016) [10] point out that 3D printing precision in generating anatomical models from patient-specific data has dual benefits including improved surgical training and preoperative planning. Realistic simulation of neurosurgical tasks can be developed using additive manufacturing processes such that skill acquisition is improved, and patient outcomes are positive. Innovative problem-solving using 3D printing received a wider range of responses, topping at 30%, rating it 2. This would suggest that while 3D printing is recognized as important, it is not yet integral to every participant’s training or practice, probably because of its recent introduction or unfamiliarity with the technology.

    Research has often been central to the goals that decide career choices and build surgical skills in medical students. Awad et al. (2016) [11] note that this trend is notably reflected in the number of medical students who receive research grants, of which more than 50% go on to pursue a residency in neurosurgery. Additional support for this view is inferred from the fact that 40% of the participants rated the lab’s role in research skills as 4, and 30% rated it as 5. Likewise, leadership and decision-making skills promoted by the non-medical resources of the lab are also rated to be four by 50% of the participants and rated to be five by 20%. This shows that the role of the laboratory goes beyond technical skills to include research competencies regarding professional development. 60% of all the participants highly rated the lab’s contribution to fostering innovation. The entire neurosurgical residency is six years in length, during which time the critical emphasis in each year has been tailored, almost in a pillar-like fashion. Lab training is organized in such a way that it complements this pillar development and progressively increases in intensity from foundational-level lab skills to more advanced surgical-based decision-making as the years progress.

    The integration of neurosurgery into the curricula of medical schools remains an important underdeveloped feature in the medical education system worldwide. Lee et al. (2020) [12] study indicated that the level of neurosurgical exposure varied grossly across different regions, with only 39.7% of students reporting any form of neurosurgical experience during their education. The idea is that regular use of the lab enhances participants’ ability to innovate in their practice. Kato et al. (2020) [1] review global disparities in neurosurgical education between developed and developing countries. Despite advances in surgical techniques or diagnostic tools, many developing regions still face huge barriers, including access to limited resources, training, and modern technology. They also advocate for international collaboration to close these gaps and support programs. Kanmounye et al. (2020) [13] discuss how the role of the Foundation for International Education in Neurological Surgery has transformed to decrease global neurosurgical disparity through education. Until recently, FIENS, founded in 1969, focused on brief mission trips but, since then, has transformed into a more sustainable model through the education of local neurosurgeons and the establishment of residency programs in LMICs. This model, labeled “service through education,” has enhanced the development of neurosurgical systems in LMICs and has led to a sustainable effect due to local ownership and international cooperation.

    Limitations

    This study has several limitations. The sample size is relatively small, limiting the generalizability of findings to a broader population of neurosurgeons and trainees. Additionally, the study relies on self-reported data, which may introduce response bias. The cross-sectional design does not allow for the assessment of the long-term impacts of the neurosurgical lab on clinical outcomes. The survey instrument was developed specifically for this study and has not been previously validated, which may influence the reliability and interpretability of the results. Moreover, all participants were active users of the lab, which may introduce selection bias and lead to an overestimation of satisfaction and perceived benefit. Furthermore, while the study highlights the effectiveness of simulation-based training, it does not compare outcomes with traditional training methods. Future research should incorporate larger cohorts, objective skill assessments, and longitudinal follow-up to validate these findings.

    Continue Reading

  • Cookd, a home-cooking start-up, raises ₹16 crore of funding in Pre-Series A Round

    Cookd, a home-cooking start-up, raises ₹16 crore of funding in Pre-Series A Round

    Founded in 2020, Cookd boasts over 6 million followers across YouTube, Instagram, and Facebook, with 150 to 170 million views on each month. 
    | Photo Credit: Special arrangement

    Cookd, a digital home-cooking start-up headquartered in Chennai, has raised ₹16 crore in a Pre-Series A Round, led by Spring Marketing Capital with participation from Eternal Capital, Sun Icon Ventures, and PeerCheque. Apart from online videos, Cookd offers a wide range of products ranging from biryani kits, masalas, cooking pastes, and ready-to-use recipe kits.

    “We will be using the funds to expand our presence in the Tamil Nadu market. We will also enter the Kerala and Andhra Pradesh market. A lot of people watch our videos in these two markets and there has been good demand,” Aathitiyan V.S., founder of Cookd told The Hindu. “With the fresh funds, we are building a new category of cooking products that combines authenticity, convenience, and control. Our goal is simple: help people cook more often and with joy,” he added.

    Founded in 2020, Cookd boasts over 6 million followers across YouTube, Instagram, and Facebook, with 150 to 170 million views on each month. Their products are being sold in over 1,600 retail stores. “Everyone in the market came up with biryani masala. We offered a kit and the formula clicked well for us,” Mr. Aathitiyan said.

    Published – July 06, 2025 10:53 pm IST

    Continue Reading

  • TikTok building new version of app ahead of expected US sale: report – World

    TikTok building new version of app ahead of expected US sale: report – World

    TikTok is building a new version of its app for users in the United States ahead the social media platform’s planned sale to a group of investors, The Information reported on Sunday, citing unnamed sources.

    This comes as US President Donald Trump said on Friday he will start talking to China on Monday or Tuesday about a possible TikTok deal. He said the United States “pretty much” has a deal on the sale of the TikTok short-video app.

    TikTok has developed a plan to launch the new app in US app stores on September 5, the report said.

    Last month, Trump extended to September 17 a deadline for China-based ByteDance to divest the US assets of TikTok.

    The report added that TikTok users will eventually have to download the new app to be able to continue using the service, although the existing app will work until March of next year, though the timeline could change.

    TikTok did not immediately respond to a Reuters request for comment. Reuters could not immediately confirm the report.

    A deal had been in the works earlier this year to spin off TikTok’s US operations into a new US-based firm, majority-owned and operated by American investors. That was put on hold after China indicated it would not approve it following Trump’s announcements of steep tariffs on Chinese goods.

    Trump said the United States will probably have to get a deal approved by China.

    Continue Reading