Category: 7. Science

If you ever lie awake at night wondering just how likely you are to die from an asteroid impact within your lifetime, a new paper has you covered.

A team led by physicist Carrie Nugent of the Olin College of Engineering in the US has calculated not just how likely it is that an asteroid will hit Earth during an average human lifespan, but how likely that impact is to cause human deaths when compared to a selection of other rare, preventable ways to die.

The bad news is that death by asteroid impact is more likely to happen to you than death by rabies. The worse news is that death from a car accident is more likely than death by asteroid impact.

The great news is that all of these likelihoods are pretty low, and you can probably live your life without too much worry (although you might want to wear a seat belt).

Related: Forget Your Troubles by Looking at These Weird But Totally Real Science Illustrations

There are good reasons to compare the risk of death by asteroid impact with the risk of death by other preventable mechanisms. Although it’s difficult to calculate exactly what the risk is – there could be a lot more potentially hazardous asteroids out there than we’ve found to date – an asteroid impact could very well be preventable too.

NASA demonstrated this back in 2022, when the space agency deliberately crashed a spacecraft into an asteroid to try to knock it off course. The mission was more successful than expected, with the asteroid in question showing a much greater change in its orbit than anticipated.

Such missions are quite costly, and require a lot of planning. By placing the risk of an asteroid impact in context with other risks, scientists can compare the potential expenditure involved with the expenditure of, say, a rabies vaccine program, or car safety features.

So, Nugent and her colleagues collected available data on the population of near-Earth objects, as well as models of these populations and previous risk assessments for asteroids more than 140 meters (460 feet) in size. From this, they calculated the impact frequency for this kind of object.

The next step was to collect available data on different kinds of deaths and compare the probability of each event occurring during the average global human lifetime of 71 years.

“Chapman and Morrison (1994) previously placed an asteroid impact in context with other causes of death such as murder, fireworks accidents, and botulism. In that work, they considered the chance of death due to an impact alongside the chance of death due to other factors,” the researchers write.

“This work addresses a slightly different question; we place the chance of an impact occurring anywhere on Earth relative to the chance of other events of concern happening to an individual. This work is therefore intended to provide context to those who wish to know the probability that a greater-than-140-meter impact will occur, anywhere on Earth, in their lifetime.”

They collected data on nine other potentially fatal events: dry sand hole collapse (that’s when a person digging a hole, on a beach for example, has the sand collapse on them); elephant attack; lightning strike; skydiving accidents; carbon monoxide poisoning; injury-causing car crash; rabies; and influenza illness.

They then calculated how likely a person would be to experience one of these events; and then how likely the person would be to die of the same (many people, for example, catch the flu without dying). This is obviously regionally variable; someone in Australia is far less likely than someone in the US to die of coyote attack or rabies.

You can see the results for yourself in the graph. Flu is similarly deadly to an asteroid impact, but far more likely to occur; the law of averages therefore suggests that it’s going to kill more people than an asteroid does. Dry sand hole collapse is almost always fatal, but has almost a one in 1 million chance of occurring within a human lifetime.

Of course, translating risk assessments like these to the real world requires some context. After all, more than three people die per year of dry sand hole collapse, tragically with an average age of 12. As far as we know, no humans have ever died from an asteroid impact. As the dinosaurs might tell you, the toll from a single strike could more than make up for a history of misses.

So the question is, is Earth overdue for another asteroid? Is caution and prevention warranted, or are we worrying unnecessarily? Does the above information comfort you, or make things worse?

It’s a bit hard to tell, really. But at least we know to stay away from sand holes.

The research will soon appear in the Planetary Science Journal. In the meantime, it’s available on preprint server arXiv.

Researchers from China Mobile published a research paper in Frontiers of Information Technology & Electronic Engineering 2024, Vol. 25, No. 5. The paper first adopts a reputation model based on the beta distribution function to measure the credibility of computing and network resource providers (CNRPs) and proposes a performance-based reputation update model . Secondly, it formalizes the problem into a constrained multi-objective optimization problem and uses a modified fast and elitist non-dominated sorting genetic algorithm (NSGA-II) to find feasible solutions, providing flexibility for matching decisions between users and resource providers.

In the industry, several approaches and methodologies have been proposed for optimization scheduling in computing and network convergence, focusing on modeling and solving resource scheduling optimization problems in the multi-cloud model through multi-dimensional resource constraints . At present, there are some studies on multi-objective optimization in the industry; reputation systems have also been widely studied in multiple domains, and beta distribution is often used in reputation modeling, but there are few studies on reputation-based scheduling in computing force networks (CFNs).

The reputation-based joint optimization framework is applied to a many-to-many system, where the CFN scheduling center connects users and CNRPs. A reputation model is introduced to evaluate the performance reliability of CNRPs, and a comprehensive evaluation model based on performance and reputation is constructed. The scheduling decision process is formulated as a constrained multi-objective optimization problem to optimize user satisfaction and average resource utilization.

The paper details the process of solving multi-objective optimization problems in CFNs based on NSGA-II, including steps such as initializing parameters, generating populations, evaluating, sorting, calculating crowding distance, selecting, crossover and mutation, and generating new populations, and finally obtaining a set of optimal solutions for users to make decisions.

The performance of the reputation-based NSGA-II in solving multi-objective optimization problems in a many-to-many CFN environment is evaluated. The impact of different parameters on average user satisfaction and resource utilization is analyzed, and the results show that the proposed reputation-based NSGA-II can achieve a balance between average user satisfaction and resource utilization . Considering the reputation of CNRPs, the proposed model, problem formulation, and NSGA-II can effectively obtain the Pareto set to jointly optimize user satisfaction and resource utilization.

Finally, the paper proposes that in the future, the fairness issue in the many-to-many matching process can be considered, and CNRPs with fewer cumulative service times can be selected while meeting user needs. Additionally, based on the service performance of CNRPs, the incentive mechanism in CFNs can be considered to decide whether to issue incentives to motivate more CNRPs to participate and promote the development of CFNs.

The paper “Reputation-based joint optimization of user satisfaction and resource utilization in a computing force network” authored by Yuexia FU, Jing WANG, Lu LU, Qinqin TANG and Sheng ZHANG. Full text of the open access paper: https://doi.org/10.1631/FITEE.2100398.

White dwarfs are the dense cores left behind when stars exhaust their fuel and collapse. They are Earth-sized stellar embers weighing typically half as much as the Sun, made up of carbon-oxygen cores with surface layers of helium and hydrogen. Using far-ultraviolet data from the NASA/ESA Hubble Space Telescope, astronomers have discovered atmospheric carbon in the long-known ultramassive white dwarf WD 0525+526, and also found that the total masses of hydrogen and helium in the star’s atmosphere are substantially lower than those expected from single-star evolution, implying that WD 0525+526 is a merger remnant.

WD 0525+526 is located approximately 130 light-years away in the constellation of Auriga.

With a mass 20% larger than our Sun, this white dwarf is considered ultramassive, and how this star came to be is not fully understood.

Such a white dwarf could form from the collapse of a massive star. However, ultraviolet data from Hubble revealed WD 0525+526 to have small amounts of carbon rising from its core into its hydrogen-rich atmosphere — suggesting this white dwarf did not originate from a single massive star.

“In optical light, WD 0525+526 looks like a heavy but otherwise ordinary white dwarf,” said University of Warwick astronomer Snehalata Sahu.

“However, through ultraviolet observations obtained with Hubble, we were able to detect faint carbon signatures that were not visible to optical telescopes.”

“Finding small amounts of carbon in the atmosphere is a telltale sign that this massive white dwarf is likely to be a remnant of a merger between two stars.”

“It also tells us there may be many more merger remnants like this masquerading as common pure-hydrogen atmosphere white dwarfs.”

“Only ultraviolet observations would be able to reveal them to us.”

Normally, hydrogen and helium form a thick barrier-like envelope around a white dwarf core, keeping elements like carbon hidden.

In a merger of two stars, the hydrogen and helium layers can burn off almost completely as the stars combine.

The resulting single star has a very thin envelope that no longer prevents carbon from reaching the surface — this is exactly what is found on WD 0525+526.

“We measured the hydrogen and helium layers to be ten-billion times thinner than in typical white dwarfs,” said University of Warwick astronomer Antoine Bédard.

“We think these layers were stripped away in the merger, and this is what now allows carbon to appear on the surface.”

“But this remnant is also unusual: it has about 100,000 times less carbon on its surface compared to other merger remnants.”

“The low carbon level, together with the star’s high temperature (nearly four times hotter than the Sun), tells us WD 0525+526 is much earlier in its post-merger evolution than those previously found.”

“This discovery helps us build a better understand the fate of binary star systems, which is critical for related phenomena like supernova explosions.”

Adding to the mystery is how carbon reaches the surface at all in this much hotter star.

The other merger remnants are later in their evolution and cool enough for convection to bring carbon to the surface. But WD 0525+526 is far too hot for that process.

Instead, the authors identified a subtler form of mixing called semi-convection, seen here for the first time in a white dwarf.

This process allows small amounts of carbon to slowly rise into the star’s hydrogen-rich atmosphere.

“Finding clear evidence of mergers in individual white dwarfs is rare,” said University of Warwick’s Professor Boris Gänsicke.

“But ultraviolet spectroscopy gives us the ability to detect these signs early, when the carbon is still invisible at optical wavelengths.”

“Because the Earth’s atmosphere blocks ultraviolet light, these observations must be carried out from space, and currently only Hubble can do this job.”

“As WD 0525+526 continues to evolve and cool, it is expected that more carbon will emerge at its surface over time.”

“For now, its ultraviolet glow offers a rare glimpse into the earliest stage of a stellar merger’s aftermath — and a new benchmark for how binary stars end their lives.”

The findings appear today in the journal Nature Astronomy.

_____

S. Sahu et al. A hot white dwarf merger remnant revealed by an ultraviolet detection of carbon. Nat Astron, published online August 6, 2025; doi: 10.1038/s41550-025-02590-y

Experimental design

Mosquito collection

1583 larvae used in this study were obtained from 17 field caught gravid Anopheles arabiensis female collected via mouth aspiration from Kigoche village (00° 34′ S, 34° 65′ E) in the Ahero irrigation scheme, Kenya and transported to the International Centre of Insect Physiology and Ecology (ICIPE)-Duduville campus in Nairobi, Kenya. During collection, a torch was used to locate Anopheles gambiae s.l. indoors on the walls of muddy houses. This was guided by identification protocol illustrated in⁶⁷; the morphological traits used were resting position, characteristics of wings and abdomen. Abdomens of the collected gravid females were morphologically examined and those observed as engorged, and dark were considered gravid. MB+ females used in these experiments were selected over three different collection timepoints. In September 2022, 1123, gravid field collected female An. arabiensis were screened for presence of Microsporidia MB, 180 were positive resulting in a 16.03% prevalence in the field (5 MB+ females were used for this experiment , offspring n = 404). In November 2022, 399 mosquitoes were screened, 142 were positive for Microsporidia MB, this recorded a prevalence of 35.58% of the symbiont in the field (5 MB+ females, offspring n = 511). In July 2023, 565 mosquitoes were screened, 75 were positive for the symbiont resulting to 13.27% prevalence in the field (7 MB+ females, offspring n = 624). The gravid females were placed in 1.5 ml micro-centrifuge tubes containing 1 cm by 1 cm Whatman filter paper to allow egg laying following the methods described in^{11,12,13,32,43}. After oviposition, they were screened for species ID⁶⁴ and the presence of Microsporidia MB^11,12,32 using PCR.

Larval rearing

Eggs from Microsporidia MB positive and negative female An. arabiensis were separated into larval trays with around 300 ml of deionised water to hatch. In three replicates, stage one (L1) larvae from the same MB+ female An. arabiensis were randomly and in equal number split into four temperature treatments: A total of 444, 515 and 624 L1 larvae were used to set up replicates one, two and three of the experiments. L1 larvae from each MB+ female An. arabiensis were divided into four equal proportions and put in four different larval trays. L1 larvae from MB− female An. arabiensis was also put in a separate larval tray for each of the temperature regimes. We, therefore, had four larval trays per each MB+ and MB− female An. arabiensis, each tray per temperature regime. One MB− female An. arabiensis was used per replicate. This was due to limited space in the incubators. We set temperature 22 °C using insect growth chamber since it supported low temperature settings. Trays for temperature 27 °C were put in an isolated room with control ambient room temperature of 27 °C. We used small incubators to set experiments for temperatures 32 °C and 37 °C, this is because these incubators could only support temperature settings above 30 °C. The number of larvae per tray in the for the MB+ female An. arabiensis were dependent on the amount of offsprings produced by each female An. arabiensis (the data of larvae per tray in each temperature regime has been attached for reference). In MB− female An. arabiensis, 23, 25 and 18 L1 larvae were used per each tray in each temperature regime for replicates one, two and three respectively. The larvae were fed on a pinch of Tetramin baby fish food throughout their development until pupation. We monitored daily larval mortality, rate and date of pupation of each pupa.

Quantification of Microsporidia MB

The ammonium acetate protein precipitation method was used for DNA extraction from offsprings of MB+ female An. arabiensis^68,69. Whole pupae were homogenised in 50 µl of phosphate buffered saline (PBS), incubated at 56 °C for 1 h in 300 µl of cell lysis buffer then we precipitated out proteins using 100 µl protein precipitate while incubating the samples in ice for 30 min. The supernatant was centrifuged for 20 min at 14,000 revolutions per minute then transferred to 300 µl of isopropanol, the samples were inverted 100 times to allow the reagents mix before centrifuging at 14,000 revolutions per minute for 1 h to remove excess salt. To obtain a clean DNA, we poured out the resulting supernatant then added 300 µl of ice cold 70% ethanol, inverted the samples 50 times then centrifuged at maximum speed of 14,000 revolutions per minute for 30 min to remove excess salts. The resultant DNA was air dried under the biosafety cabinet overnight before elution in 60 µl of nuclease free water^11,12,32,43.

All pupae collected from the experimental group (offspring of MB+ female An. arabiensis) were screened to identify those infected with Microsporidia MB using conventional PCR^11,12,32. We measured the Microsporidia MB infection rate in the collected G₀ female An. arabiensis and offspring as well and quantified Microsporidia MB density through relative quantification using qPCR. Partial Microsporidia MB 18 s gene region from each DNA sample was amplified using specific 18 s primers (MB18SF: CGCCGG CCGTGAAAAATTTA and MB18SR: CCTTGGACGTG GGAGCTATC)^{11,12,13,32,43}. The gene was then amplified in an 11 µl reaction volume of a mixture containing 0.5 µl of 5 pmol/µl reverse and forward primers, 2 µl HOTFirepol Blend Master Mix Ready-To-Load (Solis Biodyne, Estonia), 6 µl of nuclease-free PCR water and 2 µl of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95 °C for 15 min, denaturation at 95 °C for 1 min for 35 cycles, annealing at 62 °C for 30 s, a further extension for 30 s at 72 °C, and finally, final elongation for 5 min at 72 °C. To quantify the level of infection, samples positive for Microsporidia MB were subjected to relative qPCR analysis using MB18SF/MB18SR primers normalised with the reference host-keeping gene for the Anopheles ribosomal s7 gene (S7F: TCCTGGAGCTGGAGATGAAC and S7R: GACGGGTCTGTACCTTCTGG). Since the ribosomal protein S7 is a highly conserved gene in Anopheles mosquitoes, its expression levels are stable across different conditions and tissues, making it a reliable internal control for qPCR experiments⁷⁰. The qPCR reaction mixture consisted of 11 µl reaction volume containing 0.5 µl of 5 pmol/µl reverse and forward primers, 2 µl HOT FIREPol^® EvaGreen® 416 HRM no ROX Mix Solis qPCR Master mix (Solis Biodyne, Estonia), 6 µl of nuclease-free PCR water and 2 µl of DNA template. The amplification was achieved under the following conditions: initial denaturation at 95 °C for 15 min, denaturation at 95 °C for 1 min for 35 cycles, annealing at 62 °C for 60 s, and a further extension for 45 s at 72 °C. The PCR was carried out in a proflex cycler, and the qPCR was carried out in a MIC qPCR cycler (BioMolecular Systems, Australia). The MB18SF/MB18SR primers were used to confirm samples with the characteristic Microsporidia MB melt curve^{11,12,13,32,43}.

Statistical analysis

We analysed the pupation rate and age at death using Mixed-Effects Cox Models and the R “coxme” package⁷¹. The mean development time for the pupated larvae was analysed using the linear mixed-effects model using the “lme4” package. We analysed the infection rate and Microsporidia MB intensity using binomial and gaussian logistic mixed-effect model (GLMMs) and glmmTMB package. In all models, the temperature treatments, the G₀ female An. arabiensis‘ infection status, and their interactions were included as fixed terms, and the time of capture in the field was included as a random effect. In addition, the development time model also looked at the interaction between temperature treatments and infection status in offspring (Microsporidia MB negative offspring coming from un-infected colonized female An. arabiensis, Microsporidia MB positive offspring coming from field-collected infected G₀ female An. arabiensis and Microsporidia MB negative coming from field collected infected G₀ female An. arabiensis). Individuals that pupated were excluded from the age-at-death analysis. Individuals who died were excluded from the development time and infection status analysis. The Microsporidia MB intensity analysis (log transformed for better data visualisation) excluded uninfected pupae, and we used temperature treatments and transmission groups (0–33%, 33–66%, or 66–99% transmission from mother to offspring) as interaction terms in the model. We used the Tukey post-hoc test and “means” function to perform multiple comparisons among the infection status and temperature treatments⁷². P values for comparisons among treatments have been stated before the overall p values for each model done. Statistical analysis was performed using R statistical software version 4.1.2 and R Studio⁷³.

Modelling the Microsporidia MB dissemination potential

After obtaining experimental data on infection rates, development, and survival, we used these parameters to develop a mathematical model predicting Microsporidia MB dissemination in Anopheles arabiensis populations under different temperature conditions. To express the probability that an L1 offspring coming from MB+ female An. arabiensis is infected, survives to age x, and pupates at age x given temperature T, we combined the conditional probabilities:

P(infected (cap) survives to age × (cap) pupates at x| T) = P(infected| T). P (survives to age x |infected, T). P (pupates at x| infected, T).

Using the Gaussian function, the probability is given by:

(0 < x < infty).

This formula considers the conditional dependencies based on infection status and temperature, providing a logical path to estimate the combined probability.

A continuous logistic model was chosen to provide a smooth and accurate representation of mosquito population growth, reflecting natural, gradual changes without the constraints of fixed time intervals required by discrete models. This continuous approach allows precise population estimates at any point in time, making it ideal for understanding temporal growth rates and incorporating stochastic variability to reflect environmental influences on fecundity. The logistic growth equation:

was used to model the population growth of infected individuals, where N(t) is the number of MB+ individuals at time t, F represents the fecundity, r the sex ratio, ({mathbb{P}}left( {T,x} right)) the probability of infection, survival, and pupation under temperature T, and K the carrying capacity^74,75. The carrying capacity was set to 1000 to simulate real-world limitations such as resource and space constraints, establishing a stable population maximum that aligns with natural conditions. Additionally, targeting a population of 1000 MB+ offspring provides a measurable endpoint for assessing the spread of Microsporidia MB within mosquito populations. The solution to this equation,

enabled us to estimate the rate at which the population of MB+ offspring increases from an initial population of 10 MB+ female An. arabiensis, with the goal of reaching a target population of 1000 MB+ individuals.

In our deterministic simulation, parameters such as: F (fecundity), r (sex ratio), K (carrying capacity), and (N_{0}) (initial population) remained constant. Fecundity was set at three fixed rates (33, 66, or 99 viable eggs per female An. arabiensis) based on observed averages, providing a baseline for population growth under stable conditions. The sex ratio male: female was considered to be 1:1. Details of the stochastic simulation are provided in the supplementary material.

To implement this methodology, we used Python for all data processing, simulations, and statistical computations. Python’s libraries, including numpy for numerical operations, scipy for probability computations and fitting, and matplotlib for visualization, were integral to generating plots, calculating probabilities, and fitting model parameters.

Earth’s magnetic field acts like an invisible shield, protecting our planet from harmful cosmic radiation that would otherwise strip away our atmosphere and make life nearly impossible. Unlike Mars, which lost most of its magnetic protection and now faces constant bombardment from space particles, Earth has maintained this critical defence system for billions of years.

Artist impression of the interior structure of the Earth (Credit : CharlesC)

But how did this protective field form, and could it have existed when our planet was much younger? New research from scientists at ETH Zurich and Southern University of Science and Technology in China provides answers that fundamentally reshape our understanding of early Earth.

It’s long been understood that Earth’s magnetic field comes from what’s called the “dynamo effect.” Deep inside our planet, the liquid iron and nickel core slowly cools over time, creating circular currents of flowing metal called convection currents. As Earth rotates, these currents twist into screw-like patterns, generating electric currents that produce our magnetic field.

Illustration of the dynamo mechanism that generates the Earth’s magnetic field: convection currents of fluid metal in the Earth’s outer core, driven by heat flow from the inner core, organised into rolls by the Coriolis force, generate circulating electric currents, which supports the magnetic field (Credit : Andrew Z Colvin)

However, there was a significant gap in this theory. About one billion years ago, Earth’s inner core began to crystallise and solidify. Before that time, the entire core was completely liquid. The big question was whether this fully liquid core could have generated the magnetic field necessary to protect early life.

The research team developed computer models to simulate whether a completely liquid core could generate a stable magnetic field, using calculations performed on the Piz Daint high-performance computer. What made their study particularly interesting was their ability to minimise the influence of the Earth’s core viscosity to negligible levels, something no previous research had achieved. Their simulations demonstrated though that Earth’s magnetic field could indeed have been generated billions of years ago in much the same way it operates today.

“Until now, no one has ever managed to perform such calculations under these correct physical conditions.” – lead author Yufeng Lin from the Southern University of Science and Technology in China.

This discovery has far reaching implications for our understanding of how life developed on Earth. Billions of years ago, life apparently benefited from the magnetic shield, which blocked harmful radiation from space, making its development possible in the first place. Without this protection, the it’s believed that the intense radiation would have made Earth’s surface far too hostile to the delicate chemical processes that eventually led to living organisms.

The magnetic field essentially gave life on Earth a head start, creating a safer environment where complex molecules could form and evolve without being constantly disrupted by high energy particles from space.

Understanding Earth’s magnetic field isn’t just about ancient history, it’s crucial for our modern world. The magnetic field plays a crucial role in making satellite communications and many other aspects of modern civilisation possible. GPS systems, power grids, and communication networks all depend on this invisible shield. However, the field has flipped its polarity thousands of times throughout Earth’s history, and scientists have recently observed rapid shifts in magnetic north’s position. By gaining a better understanding about how the magnetic field works, researchers can make more accurate predictions about future changes and future flips that might affect our technology dependent society.

Source : A fully liquid Earth’s core also generates a magnetic field

Why are the smallest organisms in the ocean some of the most powerful forces in nature? Human society, and indeed most life on Earth, relies on microscopic marine life forms for the air we breathe, the abundance of marine life, and the cycles of nutrients and energy that make the Earth life sustaining. Portland State University (PSU) research is illuminating who those tiny beings are, what they are like, and what secrets they may hold to the future of our planet.

Anne Thompson is an assistant professor of biology at PSU. She researches phytoplankton and their interactions with other microorganisms.

“Phytoplankton are the foundation that lets us derive nourishment from the sea, and they produce some of the oxygen we breathe. So they’re really important. The group of phytoplankton that my lab studies are really tiny cells—they’re called picocyanobacteria,” Thompson said.

These cells are the most abundant photosynthetic cells on the planet.

Thompson is the head of a laboratory called Microbial Ecology PDX, where she leads a research program aimed at investigating the roles microorganisms play in nutrient cycling, symbiosis, and ecosystem resilience – and is devoted to training students, teachers, and the public in the wonder and power of microbial life in the oceans

From the open ocean to the Microbial Ecology lab

The Microbial Ecology Lab contributes critical insights to our basic understanding of life, which could lead to long-term applications in environmental stewardship, climate resilience, and biotechnological innovation.

A Precursor to Plant Life

Cyanobacteria, a subset of the larger group of phytoplankton, are a diverse lineage of organisms. Often called blue-green algae, some forms of cyanobacteria are toxic—like the ones responsible for heat-driven cyanobacterial blooms that are a safety concern for humans and pets in Portland, and throughout Oregon, during summer and early fall. The picocyanobacteria studied in Thompson’s lab are not known to be toxic, but are of great interest to researchers.

“The lineage as a whole is incredible, because it’s been around on Earth for billions of years—these are the cells that invented the production of oxygen through photosynthesis,” Thompson said. “They will be here long after we’re gone, too.”

The reason for their resilience and longevity? They don’t depend on other life in the same way we do. Instead, they derive energy from sunlight and carbon dioxide. From this they create oxygen, some can fix nitrogen, and in doing so they support entire food chains.

Predator-Prey Relationships

“The thing we’re working on now is figuring out who eats these cells. We know that they are killed by viruses. And we know that they’re eaten by single-celled organisms called protists. But we don’t know what those exact interactions are,” Thompson said.

Are the picocyanobacteria passive prey, helpless against the approach of a hungry protist? Or do they actively try to evade predators? What defense mechanisms, if any, might they have? And a crucial question: What happens to them after they’ve been eaten? Where does that organic material end up?

That last question is important to our understanding of climate science. The level of carbon in the atmosphere is a key factor influencing Earth’s climate, and the picocyanobacteria take carbon dioxide from the atmosphere. Once they are killed, does the carbon contained in their bodies get released back into the atmosphere, or does it sink to the bottom of the ocean and get buried?

Knowing more about their predators could answer this. If they get engulfed by a larger microorganism with a big fecal pellet that sinks fast, then the carbon from the phytoplankton likely gets exported—sequestered to the bottom of the sea. If they get eaten by something smaller, which does what is called sloppy feeding—taking small bites and basically making a mess—then the dissolved organic material gets recycled into the ocean, where it can easily be passed back to the atmosphere.

“If we can answer some of these questions, we hope that we’ll understand phytoplankton better, and then we’ll be able to better predict how phytoplankton can support important economies, important ecosystems, and really, the habitability of the earth,” Thompson said.

Lifelong Learning

In Thompson’s lab, there is a light incubator set to a sunrise/sunset cycle. Inside of it, a vast population of phytoplankton live, reproduce, and die. Outside of it, a group of people at all stages of their scientific careers learn from the phytoplankton and each other – training the public, students, and teachers is an important aspect of Thompson’s lab mission.

Working with teachers is one particular area of focus for Thompson. Through the M.J. Murdock Charitable Trust Partners in Science program, Thompson has hosted several STEM high school teachers in the lab where they developed their own project on phytoplankton in the open ocean and response to plastics. This formative collaboration supported by the Trust led Thompson to seek additional opportunities to support teacher education. Through NSF funding, Thompson and collaborators Claudia Ludwig and Nitin Baliga worked with eight high school STEM teachers, over the course of three summers, to translate research on picocyanobacteria into the high school curriculum. The module they created – called “Our Invisible Forest: What’s in a Drop of Seawater”, engages students in ocean science, chemistry, physics and biology – all around the idea that the ocean is teeming with microbial life.

“In addition to my work with teachers, I have a steady flow of PSU students through my lab. Currently, I have one graduate research assistant—a masters student,” Thompson said. “And then this summer I have added an undergraduate student as well, and that’s fantastic. Then I have a high school student in the lab, too. And I also have a postdoc and a research adjunct faculty member. So I have a huge range of career levels in the lab right now.” This multi-level environment benefits everyone involved—early-career students gain exposure to advanced research, while more experienced researchers sharpen their mentorship skills.

Given the urgency of our climate crisis, this is an important moment for learning more about some of earth’s key players. Picocyanobacteria love the warm, nutrient-poor open ocean. Those areas of the planet are expanding now, and will continue to expand in the years to come. As the ocean continues to change, it is likely that the picocyanobacteria will thrive. Other types of phytoplankton may not be so lucky—some live in cooler waters and need more nutrients. Many are important to coastal fisheries and human food sources. So humans have much to gain from having a better understanding of these tiny life forms and their ecological interactions.

“It’s a value to our society to understand how life works. And these incredible cells are simple. They live and die. They’ve been doing it for millions of years – and their ancestors have been doing so for billions of years! And if we can understand the secrets of how they live and persist in changing conditions, we can learn more about life itself, which has untold and immeasurable value to humans,” Thompson said.

Research with public impact is one of PSU’s top priorities. Annie Lindgren, PSU’s Associate Vice President of Research, works to advance PSU’s interdisciplinary research initiatives and build partnerships with industry and other community stakeholders.

“Dr. Thompson’s track record of funding tells a powerful story of impact in terms of both research and education. Anne recently received an Early Career Simons Foundation Award, which is a testament to her standing among the world’s most promising researchers. But it’s the early opportunities provided by M.J. Murdock Charitable Trust, and successive grants from the National Science Foundation, that truly underscore her ability to build a research program that consistently shapes new directions in microbial ecology and provides educational opportunities to learners of all ages. This has an impact far beyond the lab, and it’s why so many increasingly look to her for insight and innovation,” Lindgren said.

Astronaut Barry “Butch” Wilmore is leaving NASA after a quarter-century of service.

Wilmore flew on four different spacecraft during his astronaut career, which began way back in 2000. He spent a total of 464 days off Earth and conducted five spacewalks, during which he racked up 32 hours of outside-spacecraft time.

When low-mass stars approach the end of their main-sequence phase, they expel clouds of gas that expand to form planetary nebulae. Since they were first identified in the late 1700s, astronomers have identified nebulae of all shapes and sizes, with most appearing circular, elliptical, or bipolar. However, some nebulae stray from this pattern, including the NGC 6072 nebula located about 3,060 light-years away in the southern constellation Scorpius. In a new series of high-resolution images taken by the James Webb Space Telescope (JWST), astronomers have noted some peculiar patterns that could provide insight into the lifecycle of stars.

At first glance, the images taken using Webb’s Near-Infrared Camera (NIRCam) and Mid-Infrared Instrument (MIRI) suggest that NGC 6072 is a giant mess reminiscent of a bug splattered on a windshield. However, the structure traced by Webb’s instruments suggests that some very complex mechanisms are at work within it. The NIRCam data shows a hot central core region glowing brightly with a light blue hue, surrounded by elliptical outflows that give it a multi-polar configuration. These outflows have resulted in two lobes of gas and dust that cross the center at near-vertical angles, while a third extends perpendicularly to form an equatorial plane.

The central region covers a large area of dark pockets surrounded by orange material that grows redder the farther it is from the center. This is consistent with the gas and dust growing colder the farther it ventures from the hot central core. The three-lobe structure could mean that at least two stars are at the nebula’s center, likely consisting of a younger companion to the aging star that has already lost most of its material. The MIRI data, meanwhile, captures the longer-wavelength infrared data, which emphasizes the web-like structure created by the outflows of dust.

The NGC 6072 nebula as imaged by Webb’s MIRI instrument. Credit: NASA/ESA/CSA/STScI

This image also reveals the star that could be central to the nebula (which appears as a pinkish-white dot), as well as concentric rings expanding from the central region to the edges of the lobes. This could also be evidence of a secondary star at the center, orbiting the older star and carving out rings in its wake. Alternately, the rings could have been caused by pulsations in the outflows, where gas and dust were expelled at long intervals (every thousand years or so) in all directions. The areas represented by NIRCam (red) and MIRI (blue) both trace the cool gas in the cloud (likely molecular hydrogen), while the central regions trace hot ionized gas.

As the aging star at the center cools, the nebula will dissipate into the interstellar medium (ISM), contributing the heavier elements from which new stars and planetary systems will form. The study of planetary nebulae is a major objective for the JWST, which will provide new insights into the lifecycle of stars and their impact on the surrounding environments. These studies could also shed light on what may become of our Sun when it reaches the end of its main sequence phase, billions of years from now.

Further Reading: Webb Space Telescope

NASA and SpaceX are targeting no earlier than 12:05 p.m. EDT, Thursday, Aug. 7, for the undocking of the agency’s SpaceX Crew-10 mission from the International Space Station. Pending weather conditions, splashdown is targeted at 11:58 a.m., Friday, Aug. 8. Crew-10 will be the first mission to splash down off the California coast for NASA’s Commercial Crew Program.

NASA astronauts Anne McClain and Nichole Ayers, JAXA (Japan Aerospace Exploration Agency) astronaut Takuya Onishi, and Roscosmos cosmonaut Kirill Peskov are completing a five-month science expedition aboard the orbiting laboratory and will return time-sensitive research to Earth.

Mission managers continue monitoring weather conditions in the area, as undocking of the SpaceX Dragon depends on spacecraft readiness, recovery team readiness, weather, sea states, and other factors. NASA and SpaceX will select a specific splashdown time and location closer to the Crew-10 spacecraft undocking.

NASA’s live coverage of return and related activities will stream on NASA+, Amazon Prime, and more. Learn how to stream NASA content through a variety of platforms.

NASA’s coverage is as follows (all times Eastern and subject to changed based on real-time operations):

Thursday, Aug. 7