Blog

  • Flesh-Eating Bacteria Surge in Gulf Coast States

    Flesh-Eating Bacteria Surge in Gulf Coast States

    The term “flesh-eating bacteria” refers to bacteria that cause necrotizing fasciitis that destroys the soft tissue, particularly the fascial layer underneath the skin. Individuals with suspected cases should be treated with antibiotics immediately, as patients can die within a day or two of developing symptoms, according to the CDC.

    “V vulnificus wound infections have a short incubation period and are characterized by necrotizing skin and soft tissue infection, with or without hemorrhagic bullae,” according to a warning statement issued by the Louisiana Department of Health. The warning was issued in July 2025 after an increase in severe cases, with 17 confirmed in the state so far in 2025 alone, including four deaths compared to an average of seven cases and one death annually over the past decade.

    “Most cases of necrotizing fasciitis are due to group A streptococcus,” said Shirin Mazumder, MD, infectious diseases specialist in Memphis, Tennessee, in an interview. “Vibrio vulnificus is a rare cause of necrotizing fasciitis that can be acquired when open wounds come in contact with warm salt water or brackish water, or through ingestion of raw or undercooked seafood,” Mazumder told Medscape Medical News. “Vibrio vulnificus needs salt water to survive, so it be found in brackish water where freshwater and seawater mix,” she said. 

    Most of the Louisiana cases (75%) involved wound exposure to sea water, according to the statement. Key symptoms of infection also include watery diarrhea, abdominal pain, nausea, vomiting, and fever.

    Diagnosis is based on identification of V vulnificus in the stool, wound, or blood of a symptomatic patient, but suspected cases from water exposure should begin treatment with antibiotics immediately, without waiting for test results, according to the CDC. The CDC currently recommends antibiotic treatment with a third-generation cephalosporin such as ceftazidime, plus doxycycline, as a first-line treatment.

    Individuals with V vulnificus infections may need aggressive debridement to remove necrotic tissue, according to the CDC; in extreme cases, amputation of an infected limb is necessary. 

    When to Worry, What to Do

    “Individuals that have contact strictly with freshwater should not be concerned about exposure,” Mazumder emphasized. “The risk of vibriosis can be decreased by avoiding contact of any open wounds with salt water or brackish water, covering open wounds if there is anticipated contact with coastal water, and immediately washing any open wounds with soap and water that may have come in contact with salt or brackish water,” she said.

    The Louisiana Department of Health encourages individuals to reduce their risk for V vulnificus infection by avoiding coastal water activities if they have open wounds. Individuals with immunocompromising conditions, as well as those with diabetes or liver disease, may be especially vulnerable to infection, and the risk for exposure to V vulnificus may be greater given increased water temperatures and recent heat waves, flooding, and storms along the Gulf Coast, the Louisiana Department of Health experts wrote in the statement. 

    Although most V vulnificus infections are reported in states along the Gulf Coast, the CDC issued an official Health Advisory in the summer of 2023, when a measured above-average coastal sea surface temperatures and heat waves coincided with severe and fatal V vulnificus infectious in states along the East Coast, including New York, North Carolina, and Connecticut.

    “An increase in Vibrio vulnificus cases can be attributed to warmer weather, rising coastal water temperatures and extreme weather events such as flooding, hurricanes and storms which can force coastal waters inland,” Mazumder told Medscape Medical News. “Most cases of Vibrio vulnificus infections are found along the Gulf states; however, more cases are being identified in northeastern states due to increasing water temperature,” she noted. 

    Mazumder echoed the CDC’s recommendation for immediate initiation of antibiotics in suspected V vulnificus infections.

    “A third-generation cephalosporin in combination with either a tetracycline or fluoroquinolone should be started promptly, and antibiotic therapy can be tailored once susceptibility data is available,” said Mazumder. “In addition, supportive care is necessary, and evaluation for immediate surgical debridement should be considered in those with a skin and soft tissue infection,” she said. Appropriate diagnostic specimens should be obtained, including blood cultures, wound cultures and stool testing in patients who have diarrhea.

    Most importantly, V vulnificus is a reportable infection, so clinicians who encounter cases must contact their local health departments, Mazumder added.

    Mazumder had no financial conflicts to disclose.

    Continue Reading

  • Cosmic Discovery Shakes Up Galaxy Formation Theories

    Cosmic Discovery Shakes Up Galaxy Formation Theories

    An international team of astronomers have discovered a remarkably clumpy rotating galaxy that existed just 900 million years after the Big Bang, shedding new light on how galaxies grew and evolved in the early Universe.

    Appearing as a smooth disc in earlier images, this faint galaxy has now been revealed to contain at least 15 massive, star-forming clumps.

    That’s far more than scientists thought possible for a galaxy at such an early time in the Universe’s history.

    Our impact on space science

    We played a key role in this international research.

    Emeritus Professor Ian Smail from the Centre for Extragalactic Astronomy in our top-rated Physics Department co-authored this study.

    He contributed his experience of studying the formation of young galaxies using a phenomenon called gravitational lensing.

    This technique uses massive galaxy clusters as natural magnifying glasses, making distant galaxies look up to 100 times brighter and larger.

    Pioneered in part by our researchers, gravitational lensing has helped reveal details in galaxies that would otherwise be too fine and too faint to study.

    Challenging established theories

    The Cosmic Grapes galaxy was observed using data from two of the world’s most advanced observatories: the Atacama Large Millimetre/submillimetre Array (ALMA) and the James Webb Space Telescope (JWST).

    The findings show that this galaxy not only rotates but contains far more structure than current theories predict.

    It may represent a whole population of similar galaxies whose complexity is hidden by current telescope limits.

    As a result, scientists may need to rethink how galaxies formed and evolved in the early Universe.

    Image – Near-infrared images taken by JWST of the galaxy cluster “RXCJ0600-2007,” which causes a powerful gravitational lensing effect. Unprecedented high-resolution observations unveiled the structure of a distant galaxy in the early universe — composed of more than 15 compact star-forming clumps arranged like a “bunch of grapes” (zoom-in panel). The image represents the intrinsic view of the galaxy after correcting for gravitational lensing distortion. (Image credit: NASA/ESA/CSA/Fujimoto et al.)

    Continue Reading

  • Is 4-day holiday likely next week?

    Is 4-day holiday likely next week?



    Students wave Pakistan’s national flags at the mausoleum of the country’s founder Mohammad Ali Jinnah, during Pakistan’s Independence Day celebrations in Karachi on August 14, 2023. — AFP

    Independence Day celebrations have officially begun across Pakistan with events and activities taking place nationwide under this year’s theme “Marka-e-Haq”.

    Marka-e-Haq refers to the period of conflict with India from the April 22 Pahalgam attack to the May 10 conclusion of operation Bunyan-um-Marsoos.

    This year, parts of the country are likely to witness a four-day holiday stretch in August, as Independence Day and Chehlum of Hazrat Imam Hussain (RA) are expected to fall on consecutive days.

    According to the Cabinet Division, August 14 will be observed as a public holiday across the country to mark Independence Day.

    School students performance during Marka E Haq, Independence Celebrations at Governor House. — APP
    School students performance during Marka E Haq, Independence Celebrations at Governor House. — APP

    Chehlum, which marks the 40th day of mourning after the martyrdom of Hazrat Imam Hussain (RA), will fall on Friday, August 15.

    While it is not listed among federal public holidays, provincial governments and local administrations have the authority to declare a holiday in their respective regions.

    In 2024, the Sindh government declared holiday for all public and private schools across the province on the occasion of Chehlum.

    If similar provincial holidays are declared this year, it could result in an extended weekend — with Friday, August 16, and Saturday, August 17, combining with the official holidays for a potential four-day break.

    As of now, formal announcements for the Chehlum-related holiday at the provincial level are still awaited.

    Continue Reading

  • head-to-head record, schedule and how to watch live

    head-to-head record, schedule and how to watch live

    Victoria Mboko takes on Naomi Osaka in a mouthwatering women’s singles final at the 2025 Canadian Open.

    On paper, it is a final between two unseeded players at a WTA 1000 level tennis tournament; in reality, an enthralling battle awaits between an 18-year-old rising star and a four-time Grand Slam champion, both aiming for a maiden title of the season in Montreal.

    Mboko, who burst onto the scene earlier in the 2025 campaign with main draw debut wins at Roland-Garros and Wimbledon, now lies one match away from a first career title, at the elite WTA 1000 level just below the Grand Slams, no less.

    Doing it on home courts would be even more special.

    The Canadian has defeated three Slam champions in this tournament so far, including world no. 2 Coco Gauff and then Elena Rybakina in a three-set semi-final battle for the ages.

    Mboko faces her idol and another former major winner in Osaka, the Japanese star back in the top 50 and aiming for a first season WTA trophy. The 27-year-old’s latest WTA 1000 victory came six years ago at the 2019 China Open against fellow former world No.1 Ashleigh Barty.

    “It’s really cute,” Osaka said in a press conference, in response to being Mboko’s heroine. “I guess I have to have a really good attitude tomorrow. I can’t let her not like me anymore.”

    “I’m really honoured. I always said that I would love to play someone that looked up to me in a way, so it’s happening way sooner than I thought it would.”

    Read on for the key details to know ahead of the 2025 Canadian Open final.

    Continue Reading

  • Seoul According to: Soyoung Lee of San Francisco’s Asian Art Museum

    Seoul According to: Soyoung Lee of San Francisco’s Asian Art Museum

     

    Previously a seasoned New Yorker, Soyoung Lee started her curatorial career at the Metropolitan Museum of Art. She then moved to the Harvard Art Museums in 2018 as the chief curator, before finally reaching the West Coast, at San Francisco’s Asian Art Museum in April this year.

    Lee talks about her roots in South Korea and witnessing the astounding and, at times, jarring transformation the country and its capital has gone through for the last two decades. In particular, she talks about how Seoul’s art world has managed to re-position itself from an ‘insular bastion of Korean traditions’ to ‘the global leader of cutting-edge art’. Coinciding with this rise is the support of leading figures from the Korean diaspora in the global art world – from curators to collectors to board members – creating a perfect storm for Seoul to establish itself as the preeminent art hub of Asia.

    Soyoung Lee. Courtesy: Asian Art Museum

    Monica Jae Yeon Moon What is your relationship to Seoul?

    Soyoung Lee I was born in Jakarta, Indonesia, and spent the first five years of my life there. My dad was a diplomat for South Korea, so I’d go back and forth to South Korea. After our family landed in the US in my early teens, I spent one semester in Seoul during college as an exchange student, and again for my PhD. Over the last 20 years, I’d say I go to South Korea – and other parts of Asia – once or twice a year. And I’m still a South Korean citizen; I hold a Korean passport.

    MM How has the landscape of Seoul changed in recent years?

    SL The rapid change South Korea and Seoul have gone through is in some ways shocking. Over the last two decades the transformation – I think ‘breathtaking’ is the right word for it – has inspired wonder. Especially if people appreciate the recent modern history, where Korea came out of Japanese colonialism, the Korean war and the rapid development of the ’60s and ’70s, even the ’80s. It’s just unrecognizable.

    What I’m really inspired by in Seoul is the youth. The adoption of history by youth culture feels really distinctive to Korea and Seoul in particular. When you’re in a cultural space, like the National Museum of Korea, you can see that in recent years it has been transformed. They’ve been really savvy about taking advantage of Korean pop culture and adapting it in their spaces, even in their collection. Their museum shop is all the rage. What was known as a bastion of tradition has been very nimble in responding to younger generations.

    The adoption of history by the youth culture feels really distinctive to Korea and Seoul particular. Soyoung Lee

    MM How does Seoul differ from other Asian cities, such as Hong Kong or Tokyo?

    SL What’s really exciting, particularly for non-residents visiting Seoul, is that balance between the traditional and new.

    There’s both the speed – literally – of the city’s traffic and people, and the speed of life. And yet there are spaces that allow for a slower pace of life and introspection. It’s a tension, but also a harmony between these extreme facets of a metropolis. Many cities, like Hong Kong or Tokyo, have versions of it, but I think in Seoul that tension is inviting, not overwhelming. Tokyo’s obviously still a global city, but the global embrace of Korean pop culture has completely transformed the city in reality and in perception. You could argue that the torch was passed to Seoul some time ago.

    Changdeokgung Secret Garden. Courtesy: Soyoung Lee
    Changdeokgung Secret Garden. Courtesy: Soyoung Lee 

    MM What about Seoul’s creative scene or art landscape? How has it changed and how do you see it evolving?

    SL Seoul has risen as an international hub for contemporary art. Obviously it’s a centre for Korean contemporary art, but it’s becoming a hub for contemporary artists of the Asian diaspora and Japan, Southeast Asia and China.

    Curators at our museum admire Seoul’s underground, including performance and sound art. And Seoul’s one of the most tech-savvy places in the world: that’s reflected in the art and culture scene as well.

    With rapid modernization in the late 20th century, there was this fear that we were gonna lose the old Korea. People thought that the uniqueness of Korea was its traditions. So coming from this point, the creation of a contemporary art market is astounding. They’ve figured it out; not only have they figured it out, they’re showing the world where the future is.

    MM Why has Seoul emerged as such a significant art hub in Asia?

    SL Initially there were influential major collectors, like the Lee family of Leeum Museum. Amore Pacific is another example whose founder was incredibly keen, savvy and committed to art. More recently, there are Korean diaspora collectors of contemporary art around the world, particularly in New York, who’ve become major influencers and they’re going back to Seoul and participating in Frieze.

    Also, the art and cultural world in Seoul has become much more global in its perspective and understanding of global art history. The success of Korean art and Seoul’s art scene came about because it opened up what it means to be Korean. The city has become more international in its own perception of itself, in its interaction with and in its presentation to the external world.

    Seoul has become more international in its own perception of itself. Soyoung Lee

    Finally, the Korean government’s investment in so-called soft power can’t be overstated. It’s a small country; it’s a small culture. There’s a community coalescing around what is good for Korea, and how we promote the image of Korea abroad, whether that’s traditional or pop culture, or contemporary art. That’s been really smart.

    Korea Artist Prize 2024 at MMCA. Courtesy: Soyoung Lee
    Korea Artist Prize 2024 at MMCA. Courtesy: Soyoung Lee

    MM What are some of the exhibitions you’ve seen recently that made you feel this way?  

    SL I was impressed with the MMCA(National Museum of Modern and Contemporary Art, Korea)’s Annual Korea Artist Prize show earlier this year. While they’re promoting Korean contemporary art, their artists and themes have global resonance. Whether it’s issues of environment, materiality or identity, they’re consciously built around themes that have global resonance.

    And Leeum is a great example: when they started their collection, they were known for keeping traditional Korean art alive, but they’re also this powerhouse in modern and contemporary art. Every year, they do these shows with major international artists. And because they’ve led that, many international and homegrown galleries are doing both Korean and international shows.

    MM What (global, cultural, local) issues are you interested in these days?  

    SL What I’m interested in is how we explore the notions of identity beyond the current US-based discourse. I’d love for the Asian Art Museum to not only be a bridge between Asia and North America, but to lead the conversation around what it means to be Asian, Asian American and Asian diaspora, There are a number of Korean artists who open up the question of identity in really interesting ways.

    MM Such as who?

    SL One of my favorite contemporary artists is Lee Bul, who’s got a major retrospective at Leeum in September. She has always resisted categorization and labelling. She does not like to be known as a Korean artist because she’s an international artist. Even though her practice has been informed very much by her upbringing and life in Seoul and South Korea, she explores questions of feminism or female identity, and the tension between new technology – or the beyond-human – and what it means to be human.

    There’s also Minouk Lim, who is based in Seoul, who just did a small show at the Ilmin Museum of Art. She’s very conceptual but she addresses questions of how we relate to and tackle changing environment, but also around questions of identity. Do Ho Suh, who is based in London, has constantly worked around the notion of home, informed by his Korean identity.

    Many young artists are thinking about climate or environment. In a dense modern city like Seoul, that seems to be becoming even more of a relevant and urgent question for young people in general: how do we deal with these rapid changes in our environment, in a country that’s gone through so much rapid change within a short span of decades in the modern period?

    Minouk Lim "Hyper Yellow" at Ilmin Museum of Art. Courtesy: Soyoung Lee
    Minouk Lim “Hyper Yellow” at Ilmin Museum of Art. Courtesy: Soyoung Lee

    MM Do you have people around you who visit Seoul for its art market ?   

    SL We have these powerhouse Korean American women on the board of the Asian Art Museum, as well as in the broader Asian diaspora. They probably would call themselves emerging collectors and their interests lie within the pan-Asian field. They’ve been to Frieze Seoul more times than I have. There are also curators from the Asian Art Museum and colleagues around museums in the US, like Hyunsoo Woo at the Philadelphia Museum, and Miyoung Lee at the Whitney Museum. She’s been an incredible supporter of Korean curators and artists.

    The rise of these influential figures in the US elevate the awareness around Asian and Asian American culture and experiences. I think this is fantastic and impactful in motivating others to visit cities like Seoul.

    MM Finally, what’s your favourite place to eat in Seoul?  

    SL The transformation of Insa-dong is a microcosm of Seoul. There are pockets of it where you could still encounter kind of authentic traditions, but it’s also become this cool hangout spot with tiny teahouses and various eateries to explore. One of the Korean restaurants I went to there is called A Flower Blossom on the Rice. I thought it was emblematic of the melding of tradition and super-cool, contemporary chic. And the food was tasty.

    A Flower Blossom on the Rice. Courtesy: Soyoung Lee
    A Flower Blossom on the Rice. Courtesy: Soyoung Lee

    The other thing about Seoul that I love is department stores, which is something you don’t have in North America. Not the department stores for the shopping so much, but the food halls at the basement of the department stores where you can sample an assortment of dishes. I’m in heaven when I go to a Seoul department store.

    Further Information 

    Frieze Seoul, COEX, 3 – 6 September 2025.   

    Discounted tickets are now sold out, limited full-price tickets available. Become a Frieze Member for premier access, multi-day entry, exclusive guided tours, and more. 

    BUY NOW 

    For all the latest news from Frieze, sign up to the newsletter at frieze.com, and follow @friezeofficial on Instagram and Frieze Official on Facebook. 

    Frieze Seoul is supported by Headline Partner LG OLED, in a collaboration that merges the worlds of art and technology, and Global Lead Partner Deutsche Bank, continuing over two decades of shared commitment to artistic excellence.

    Main image: Morehshin Allahyari, She Who Sees The Unknown: The Queer Withdrawings, 2022-2023. Silver, mirror vinyl (site-specific installation). “Rave into the Future: Art in Motion”, Asian Art Museum. Photo by Gina Clyne. Courtesy: the artist, OXY Arts, and Asian Art Museum 


    Continue Reading

  • Jaffer Express narrowly escapes explosion near Sibi railway track

    Jaffer Express narrowly escapes explosion near Sibi railway track




    QUETTA (Dunya News) – A bomb blast occurred near a railway track in the Sibi district of Balochistan, narrowly missing the Jaffer Express.

    According to officials, the explosion took place just after the Jaffer Express, coming from Punjab, had passed by — sparing it from any damage. No casualties were reported. Security forces quickly cordoned off the area and launched a search operation.

    Police officials stated that the blast site and railway track are being examined, and evidence is being collected. Investigations are underway to determine the type of explosive used and the intended target.

    Read also: Jaffar Express’ pilot engine attacked in Balochistan, no casualty reported

    This incident comes shortly after a terrorist attempt on the same train earlier this week. On Monday morning, the Jaffer Express, traveling from Quetta to Peshawar, was fired upon near Kolpur, targeting the pilot engine. The train had to stop at Dozan Railway Station. The engine was hit by five bullets, but the crew remained unharmed.

    The attack was claimed by a group named “Fitna-e-Hindustan”, which has been involved in past attacks on the Jaffer Express.

    It’s worth noting that in March 2025, 26 passengers were martyred in an attack on the same train traveling from Quetta to Peshawar. Additionally, in June 2025, a bomb explosion in Jacobabad, Sindh, caused four coaches of the Jaffer Express to derail, although all passengers survived that incident.

     


    Related Topics


    Subscribe Dunya News on YouTube

    ‘ ; r_text[1] = ” ; r_text[2] = ” ; r_text[3] = ” ; r_text[4] = ” ; r_text[5] = ” ; r_text[6] = ” ; var i = Math.floor(r_text.length * Math.random()); document.write(r_text[i]);

    Continue Reading

  • Mariah Carey hails ‘amazing’ Brighton Pride crowd

    Mariah Carey hails ‘amazing’ Brighton Pride crowd

    Singer Mariah Carey has hailed the crowd at her Brighton Pride show as “amazing”.

    The five-time Grammy winner, who has sold more than 220 million albums worldwide, performed in Preston Park on Saturday as the headline act.

    “I loved it. The people were amazing and just being there amongst friends was really nice,” she told the Scott Mills Breakfast Show on BBC Radio 2.

    The 56-year-old also highlighted her long-standing connection to the LGBTQ+ community, adding: “I feel like there’s a mutual love between us.

    “My mother had two friends and they were my guncles [gay uncles], and I would put on plays for my guncles.

    “I think it was a thing that helped me in my life, being around all different people.”

    By performing on Saturday night, Carey fulfilled a promise made to fans and Pride’s organisers in 2020.

    She had been booked to headline that year, but the Covid-19 pandemic meant the annual event was cancelled.

    During the performance at Brighton Pride, Carey sang Hero and Fantasy, along with Sugar Sweet from her upcoming 16th studio album, Here For It All.

    Since her career began in the late 1980s, Carey has had three UK number one singles and two UK number one albums.

    One of her best known songs is All I Want For Christmas Is You.

    Continue Reading

  • NASA supercomputer reveals how Greenland ice melt boosts ocean life

    NASA supercomputer reveals how Greenland ice melt boosts ocean life

    A new NASA-backed study has found an unexpected effect of Greenland’s melting ice: the runoff is causing a surge in tiny ocean life. This could have implications for the marine ecosystem and the global carbon cycle.

    Scientists have used powerful computer models to study the difficult-to-reach ocean waters around Greenland. 

    NASA’s Jet Propulsion Laboratory in Southern California and the Massachusetts Institute of Technology in Cambridge developed the ECCO-Darwin computer model.

    This model combines billions of data points to simulate the relationships between ocean physics and marine life, allowing researchers to study how melting glaciers affect the ecosystem.

    How is ice melt boosting phytoplankton in Greenland?

    Greenland‘s majestic ice sheet is undergoing major changes due to changes in the climatic conditions. It’s mile-thick ice sheet annually loses about 270 billion tons of ice.

    The peak summer melt sends over 300,000 gallons (1,200 cubic meters) of freshwater into the sea, particularly from glaciers like Jakobshavn. 

    This freshwater meets the saltwater below, creating turbulent plumes.

    NASA scientists believe meltwater from glaciers acts like an elevator, lifting crucial nutrients like iron and nitrate from the deep ocean to the sunlit surface. 

    As per NASA, this process boosts the growth of tiny, plant-like organisms called phytoplankton. 

    However, directly observing this process in Greenland’s remote and icy coastal waters is incredibly challenging. 

    “We were faced with this classic problem of trying to understand a system that is so remote and buried beneath ice. We needed a gem of a computer model to help,” said Dustin Carroll, an oceanographer at San José State University affiliated with JPL.

    Supercomputers and the math of melting ice

    The model ECCO-Darwin, which stands for Estimating the Circulation and Climate of the Ocean-Darwin, was used to study remote ocean areas.

    To solve the massive mathematical problem of simulating how biology, chemistry, and physics interact in a fjord, scientists built a “model within a model within a model.”

    The focus was on a single turbulent fjord at the foot of the Jakobshavn Glacier, the most active on the ice sheet.

    The team used NASA supercomputers to simulate glacial runoff.

    It was calculated that the nutrients carried upward by glacial meltwater could increase summertime phytoplankton growth in the study area by a substantial 15% to 40%.

    This finding helps to explain why previous satellite data showed a 57% surge in phytoplankton growth in Arctic waters between 1998 and 2018.

    In fact, on June 16, 2024, NASA’s Aqua satellite captured an image of a large phytoplankton bloom in the North Atlantic Ocean. Reportedly, about 800 kilometers wide, the bloom was located east of Greenland and south of Iceland.

    Phytoplankton, though smaller than a pinhead, are vital to the planet and the ocean’s food web. These organisms absorb carbon dioxide and feed krill and other small animals, making food for larger creatures like fish and whales.

    Scientists are unsure whether this boost in phytoplankton will have a long-term positive effect on marine life and fisheries.

    With Greenland’s ice melt projected to accelerate, its effects on the ecosystem—from sea level to the salinity of coastal waters—are still being untangled.

    The study team plans to expand its simulations to understand the impact along the Greenland coast and beyond.

    The findings were reported in the journal Nature Communications: Earth & Environment. 

    FAQs

    How big is the Greenland Ice Sheet?

    Greenland’s ice sheet spans 1.7 million square kilometers, with an average thickness of 2.3 kilometers (1.4 miles), and contains 7% of the world’s freshwater.

    What animals live in Greenland?

    Greenland’s wildlife includes several well-known Arctic animals like the polar bear, musk ox, Arctic fox, and reindeer, although the number of land mammals is small.

    Continue Reading

  • Time to move on from South Africa’s WTC win, says Rabada

    Time to move on from South Africa’s WTC win, says Rabada

    South Africa’s leading paceman Kagiso Rabada says it is time to move on from the euphoria of beating Australia in the World Test Championship final wile admitting a belated major trophy success has come as a relief to his team.

    Rabada will lead South Africa’s attack as they take on Australia in three Twenty20 clashes and three one-day Internationals starting in Darwin on Sunday.

    “I think it was special, and I’ve done so many interviews on that since,” Rabada said of South Africa’s victory over Australia at Lord’s in June.

    “I think it’s time to move on. I don’t think we’ll forget about that ever as a team, and South Africa won’t ever (forget), but time to move on now.” he told a press conference on Thursday.

    The five-wicket win in the WTC final followed several frustrating near misses for South Africa in limited-overs World Cups.

    “It was kind of like a relief. But the show moves on, and moving toward the T20 World Cup, I guess the approach will be a bit different. Now, you know, there’s no fear of anything.”

    Rabada is relishing a reprisal of the rivalry between Australia and South Africa.

    “It’s always some hard cricket being played, some good cricket,” he said. “Whenever we play Australia, I always feel like they get the best out of us, because they’re sort of in our faces. And I guess we like that.”

    Rababa, who turned 30 in May, has not played since the WTC final in London.

    “Thankfully, I’ve had quite a long break, so that’s been awesome. Maintenance work consistently has to be done because the volume of cricket is quite a bit.”

    The Australia tour comes ahead of next year’s T20 World Cup in India and Sri Lanka, and the 2027 World Cup in Southern Africa, and South Africa hope the experience will benefit the young players in their squad.

    “For me that’s extremely exciting to see them raring to go. It’s just about trying to see where we’re at as a team, moving into almost like another generation,” Rabada added. REUTERS

    Continue Reading

  • Study of the Association of EDN1 rs5370 Polymorphism to Type 2 Diabete

    Study of the Association of EDN1 rs5370 Polymorphism to Type 2 Diabete

    Introduction

    Diabetes is a set of metabolic disorders characterized by persistently high blood glucose levels, which can cause damage to various parts of the body and lead to dysfunction.1

    Diabetes mellitus type 2 (T2DM) is common in the Arab population and around the world. In Saudi Arabia, T2DM ranks second in the Middle East and seventh globally. The number of cases worldwide is expected to rise to more than 500 million by 2030.2 Elevated blood glucose and insulin resistance are the main features of the disease. In addition, as the disease progresses, several comorbidities develop, including retinopathy, nephropathy, hypertension, cardiovascular disease, neuropathy, and others. The disease can be avoided by improving lifestyle choices such as balanced diet, physical activity, and quitting smoking.3,4

    A complex interaction between genetic and environmental factors is thought to be the cause of T2DM.5 Endothelin is a group of endogenous peptides synthesized in various tissues and acting as regulators of growth, vascular tone, and hormone synthesis. Endothelin is released mainly from endothelial cells. Endothelin has many isoforms, the most common of which is ET-1.6,7 ET-1 acts by interacting with both type A and type B receptors, leading to cell growth and vasoconstriction.8,9 ET-1 plays a role in the pathophysiology of cardiovascular diseases and renal diseases. For example, endothelial dysfunction leads to increased in ET-1 production, resulting in atherogenesis, vascular hypertrophy, and glomerulosclerosis.10–12 Patients with T2DM have been found to have increased levels of ET-1 in their plasma.13,14 Treatment of cultured human cells with glucose has been shown to increase the expression of ET-1 via epigenetic mechanisms.15 In addition, variations in the END1 gene have been shown to modulate the development of some morbidities associated with T2DM.8,16 The rs5370G>T polymorphism of the EDN1 gene is a mis-sense mutation that causes the replacement of lysine by asparagine in ET-1. This polymorphism has been shown to impact ET-1 in the circulation.17,18 In addition, the rs5370 polymorphism has been associated with some T2DM complications.19 In the present study, the associations between ET-1 and END1 rs5370 polymorphism with susceptibility to T2DM and its associated complications were examined among patients from Saudi Arabia.

    Materials and Methods

    Study Subjects

    The study was case-control in design and included 190 subjects with T2DM (case group) and 120 healthy subjects (control group). Patients were recruited from various hospitals in Madinah, SA during the period since 07 January 2024 to 05 January 2025. Patients were diagnosed with T2DM based on World Health Organization (WHO) diagnostic criteria, which include HbA1C ≥ 6.5%, and fasting blood glucose (FBG) ≥7.0 mmol/L. Patients with acute illnesses, cancer, pregnant women, and liver diseases were excluded from cases and controls. Nephropathy diagnosis based on glomerular filtration rate (GFR) less than 60 mL/min, and urine albumin-to-creatinine ratio (UACR) ≥ 30 mg/g,20 any borderline or type 1 diabetes were excluded. Retinopathy diagnosed by fundus findings (microaneurysms, hemorrhages, neovascularization) with retinal imaging.21 Cardiovascular disease diagnosed based to ADA outlines includes clinical and lab markers.22 Neuropathy diagnosed based to American academy of neurology includes clinical signs and nerve conduction study.23

    The study protocol was permitted by the “Research Ethics Committee” of Taibah University (Approval No. CLS 202097). The committee operates in accordance with the “1964 Declaration of Helsinki and its amendments”. Written informed consent was obtained from study participants prior to participation.

    Biochemical Parameters

    Blood samples were collected from participants in oxalate tubes for blood glucose testing and in EDTA tubes for other measurements. ET-1 levels were measured using an ELISA assay developed by Thermo-Fisher company (USA).24 Glucose, lipids, urea, creatinine, and albumin levels were measured enzymatically with Dimension® EXL™ 200 Integrated Chemistry analyzer (Siemens, Erlangen, Germany). Albumin to creatinine ratio was measured as previously described.25 HbA1c was determined using a D-10™ Hemoglobin Analyzer from Bio-Rad (Nyocard, USA).

    DNA Extraction

    Blood DNA was extracted using a kit obtained from Fermentas company (USA). The quality/quantity of extracted DNA were verified using spectrophotometric methods by measuring absorbance at a wavelength 260/280 nm. DNA was kept at −30°C until further applications.

    Genotyping of EDN1 rs5370 Polymorphism

    The “polymerase chain reaction amplification-refractory mutation system (PCR-ARMS)” was used to genotype EDN1 rs5370 polymorphism as previously described.26 PCR amplification was performed using a thermocycler obtained from BioRad (model MT100tm, USA). The used primers were: Reverse common primer 5´AGTCAGGAACCAGCAGAGGA3´, and forward allele specific primers: G allele- 5´ATCCGAAGCTGAAAGGCAAG3´, and T allele-5´ATCCGAAGCTGAAAGGCAAT3´. PCR reaction was performed in 0.5mL PCR tube in a total reaction volume of 25µL (2X master mix obtained from ThermoFisher Scientific, 100ng of genomic DNA and 50 pmol of each primer. Two reactions for each sample were performed to distinguish amplification from the two forward primers. Amplification conditions were denaturation (5min/95°C), 35 cycles (95°C/60s, 58°C/45s and 72°C/45s), and a final extension (72°C/5min). Gel electrophoresis was performed on 2.5% agarose gel, and DNA fragments were visualized under UV light and EtBr. The amplified PCR fragment from each forward primer was 179bp. Amplification from both allele specific primers indicates the heterozygous genotype (GT). Amplification from a single allele specific primer indicates the homozygous genotype (GG or TT depending on the forward primer used).

    Statistical Analysis

    Data were analyzed using SPSS version 23. For comparison, the unpaired Student’s t-test, ANOVA, Fisher exact test, or Chi-square test were used as appropriate. A P<0.05 indicates a statistically significant difference.

    Results

    Baseline Characteristics of Participants

    Table 1 shows the demographic and clinical data of T2DM patients and the control group. No statistical differences were observed in gender, age, and smoking status between the two groups (P>0.05). On the other hand, there were differences between patients and controls in fasting blood glucose, HbA1c, lipid profile, urea albumin to creatinine ratio, creatinine, nephropathy, retinopathy, neuropathy, cardiovascular disease, and hypertension (P<0.05). Plasma ET-1 levels in the studied groups. ET-1 was significantly higher in patients than controls (p<0.01).

    Table 1 Demographic and Clinical Characteristics of Participants

    Distribution of END1 Gene rs5370 Polymorphism

    Table 2 shows the distribution of genotypes and alleles of the rs5370 EDN1 polymorphism among T2DM and controls. The rs5370 EDN1 polymorphism is in Hardy-Weinberg equilibrium in the study sample (P=0.113). The frequency of the G allele was 78.3% in the control group and 74.7% in the T2DM group (P=0.306). The frequencies of the GG, GT, and TT genotypes were 60.8%, 35%, and 4.2% in the control group and 53.7%, 42.1%, and 4.2% in the T2DM group, respectively (P=0.447). Thus, the rs5370 polymorphism was not associated with susceptibility to T2DM in the studied population (P>0.05).

    Table 2 Distribution of ET-1 (EDN1) Gene rs5370 Polymorphisms Genotypes and Alleles in Patients with T2DM Diabetic and Controls

    Distribution of END1 Gene rs5370 Polymorphism with Different Aspects

    To further examine the contribution of the EDN1 gene rs5370 polymorphism to T2DM pathology, Table 3 shows the different clinical measures across rs5370 genotypes in T2DM group. The results showed a significantly high frequency of nephropathy among patients with TT genotype compared to patients with the GG genotype (P=0.033, OR [95% CI]: 8.14 [1.60–41.32]). In addition, BMI, total cholesterol, fasting glucose, and ET-1 were significantly higher in patients with TT genotype compared to other genotypes (P<0.05). With respect to the relationship between cardiovascular disease and the rs5370 polymorphism, a marginal association was observed (P=0.060; OR [95% CI]: 1.75 [0.80–3.81]). However, no association was observed between rs5370 and T2DM complications including neuropathy OR [95% CI]: 0.82 [0.25–2.73]), hypertension (OR [95% CI]: 1.64 [0.69–3.89]), and retinopathy (OR [95% CI]: 1.75 [0.70–4.39]). Moreover, rs5370 did not affect biochemical parameters including HbA1c, LDL, and HDL among T2DM (P>0.05). Thus, the TT genotype seems to impact several clinical parameters in T2DM.

    Table 3 Distribution of ET-1 (EDN1) Gene rs5370 Polymorphisms Genotypes and Alleles in Patients with T2DM with Different Clinical and Anthropometric Aspects

    Discussion

    T2DM predisposes individuals to numerous complications, including hypertension, neuropathy, cardiovascular disease, nephropathy, and retinopathy. T2DM is caused by both genetic and environmental factors. Hundreds of genetic variations have been shown to modulate the risk of developing T2DM.27

    The rs5370 variant of the EDN1 gene causes a Lys/Asn amino acid substitution, which may impact ET-1 maturation in endothelial cells.28 The clinical significance of rs5370 is well documented.29–31 In the current study, we investigated the possible association between the rs5370 and T2DM complications.

    The study showed no association between rs5370 EDN1gene polymorphism and T2DM. This finding is consistent with previous studies conducted in Caucasian, Chinese and Jordanian populations.19,25,32 Thus, it appears that the rs5370 polymorphism does not affect the risk of T2DM.

    The study also examined the relationship between T2DM complications and the rs5370 polymorphism. The rs5370 was found to be associated with nephropathy and marginally associated with cardiovascular disease in T2DM. The rs5370 TT genotype was found to increase the risk of these complications in T2DM. A meta-analysis reported that the rs5370 increased the risk of ischemic stroke.29 In a study conducted in Iran, rs5370 was found to be associated with coronary atherosclerosis.33 In addition, rs5370 was found to be associated with the severity of coronary artery disease in the Russian population.34 In contrast, no association between rs5370 and nephropathy was observed among Caucasians with T2DM.25,35 The current study showed no association between the rs5370 and blood pressure, neuropathy, and retinopathies in T2DM patients. Similar findings have been reported in studies from Iran, Jordan, and China.32,33,36 However, a previous study reported an association between rs5370 and retinopathy in T2DM patients.19 Moreover, the rs5370 polymorphism has been shown to impact blood pressure in individuals with obesity.28,37–39 Thus, the association between rs5370 and complications of T2DM seems to be complex and modulated by the genetic background of the population.

    In the present study, ET-1 levels were found to be elevated in T2DM, consistent with previous studies.40–42 Moreover, in a recent in vitro study in Saudi Arabia, there was a markedly elevated in EDN1 gene expression as a result of exposure to high glucose in cell culture.43 ET-1 is a vasoconstrictor agent and involved in fibrosis and inflammation responses. ET-1 has been found to impact renal function through modulation of vascular/mesangial tone; ions excretion; and cell division and matrix remodeling.8,44

    Among the limitations of the study is the low sample size, specially number of individuals with T2DM complications, which might lower the study power analysis. In addition, data regarding covariates that might impact observed associations like duration of diabetes, medication use, or family history were not collected. Therefore, we recommend a larger study to confirm the study findings.

    Conclusions

    Circulatory ET-1 levels are elevated in patients with T2DM. The EDN1 rs5370 polymorphism might impact the risk of nephropathy in T2DM. Further studies with a larger sample are needed to confirm the present findings.

    Ethics

    Ethical clearance for this research was obtained from the Research Ethics Committee at the College of Applied Medical Sciences, Taibah University, Madinah, Saudi Arabia (Approval No. CLS 202097), following the ethical guidelines established in the 1964 Declaration of Helsinki and its later revisions.

    Acknowledgments

    The authors express gratitude to the college of Applied Sciences at Taibah University for their support.

    Author Contributions

    All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.

    Funding

    This research received no external funding.

    Disclosure

    The authors report no conflicts of interest in this work.

    References

    1. Organization WH. Classification of diabetes mellitus. In: Classification of Diabetes Mellitus. 2019.

    2. Laakso M, Kuusisto J. Insulin resistance and hyperglycaemia in cardiovascular disease development. Nat Rev Endocrinol. 2014;10(5):293–302. doi:10.1038/nrendo.2014.29

    3. Magliano DJ, Boyko EJ, Atlas ID. What is diabetes? In: IDF DIABETES ATLAS [Internet]. 10th edition ed. International Diabetes Federation; 2021.

    4. AlJabr Q, Alalawi M, Aldhneen B, et al. Association of BMI and incidence of type 2 diabetes in Saudi population. Health Sci Rep. 2024;7(3):e1951. doi:10.1002/hsr2.1951

    5. Mambiya M, Shang M, Wang Y, et al. The play of genes and non-genetic factors on type 2 diabetes. Front Public Health. 2019;7:349. doi:10.3389/fpubh.2019.00349

    6. Yanagisawa M, Kurihara H, Kimura S, et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332(6163):411–415. doi:10.1038/332411a0

    7. Rubanyi G, Botelho LP. Endothelins 1. FASEB J. 1991;5(12):2713–2720. doi:10.1096/fasebj.5.12.1916094

    8. Zanatta CM, Crispim D, Sortica DA, et al. Endothelin-1 gene polymorphisms and diabetic kidney disease in patients with type 2 diabetes mellitus. Diabetol Metab Syndr. 2015;7(1):1–8. doi:10.1186/s13098-015-0093-5

    9. Levey AS, Coresh J, Balk E, et al. National Kidney Foundation practice guidelines for chronic kidney disease: evaluation, classification, and stratification. Ann Internal Med. 2003;139(2):137–147. doi:10.7326/0003-4819-139-2-200307150-00013

    10. Ohta K, Hirata Y, Shichiri M, et al. Urinary excretion of endothelin-1 in normal subjects and patients with renal disease. Kidney Int. 1991;39(2):307–311. doi:10.1038/ki.1991.38

    11. Benigni A, Perico N, Remuzzi G. Research on renal endothelin in proteinuric nephropathies dictates novel strategies to prevent progression. Curr Opin Nephrol Hypertens. 2001;10(1):1–6. doi:10.1097/00041552-200101000-00001

    12. Hocher B, Schwarz A, Reinbacher D, et al. Effects of endothelin receptor antagonists on the progression of diabetic nephropathy. Nephron. 2001;87(2):161–169. doi:10.1159/000045906

    13. Seligman B, Biolo A, Polanczyk CA, Gross JL, Clausell N. Increased plasma levels of endothelin 1 and von Willebrand factor in patients with type 2 diabetes and dyslipidemia. Diabetes Care. 2000;23(9):1395–1400. doi:10.2337/diacare.23.9.1395

    14. Schneider JG, Tilly N, Hierl T, et al. Elevated plasma endothelin-1 levels in diabetes mellitus. Am J Hypertens. 2002;15(11):967–972. doi:10.1016/S0895-7061(02)03060-1

    15. Biswas S, Feng B, Thomas A, et al. Endothelin-1 regulation is entangled in a complex web of epigenetic mechanisms in diabetes. Physiol Res. 2018;67:S115.

    16. Tziastoudi M, Stefanidis I, Zintzaras E. The genetic map of diabetic nephropathy: evidence from a systematic review and meta-analysis of genetic association studies. Clin Kidney J. 2020;13(5):768–781. doi:10.1093/ckj/sfaa077

    17. Aggarwal PK, Jain V, Srinivasan R, Jha V. Maternal EDN1 G5665T polymorphism influences circulating endothelin-1 levels and plays a role in determination of preeclampsia phenotype. J Hypertension. 2009;27(10):2044–2050. doi:10.1097/HJH.0b013e32832f7f3f

    18. Barden AE, Herbison CE, Beilin LJ, Michael CA, Walters BN, Van Bockxmeer FM. Association between the endothelin-1 gene Lys198Asn polymorphism blood pressure and plasma endothelin-1 levels in normal and pre-eclamptic pregnancy. J Hypertension. 2001;19(10):1775–1782. doi:10.1097/00004872-200110000-00011

    19. Li H, Louey JW, Choy KW, et al. EDN1 Lys198Asn is associated with diabetic retinopathy in type 2 diabetes. Mol Vision. 2008;14:1698.

    20. Cao H, Song L, Wang X, Guan H. Non-linear relationship between urinary creatinine and diabetic kidney disease: implications for clinical practice. BMC Nephrol. 2025;26(1):40. doi:10.1186/s12882-025-03971-1

    21. Flaxel CJ, Adelman RA, Bailey ST, et al. Diabetic retinopathy preferred practice pattern®. Ophthalmology. 2020;127(1):P66–P145. doi:10.1016/j.ophtha.2019.09.025

    22. Cardiovascular disease and risk management: standards of care in diabetes—2025. Diabetes Care. 2025;48(Supplement_1):S207–S238. doi:10.2337/dc25-S010

    23. Elafros MA, Callaghan BC. Diabetic neuropathies. Continuum. 2023;29(5):1401–1417. doi:10.1212/CON.0000000000001291

    24. Liang L-L, Chen L, Zhou M-Y, et al. Genetic susceptibility of five tagSNPs in the endothelin-1 (EDN1) gene to coronary artery disease in a Chinese Han population. Biosci Rep. 2018;38(5):BSR20171320. doi:10.1042/BSR20171320

    25. Šeruga M, Kariž S, Makuc J, et al. Endothelin-1 gene polymorphisms rs5370, rs1476046, and rs3087459 are not associated with diabetic nephropathy in Caucasians with type 2 diabetes mellitus. Folia Medica. 2017;59(3):261–269. doi:10.1515/folmed-2017-0033

    26. Rizk H, Hammad A, El-Said A, Wahba Y. Endothelin-1 rs5370 gene polymorphism in primary nephrotic syndrome: a case-control study. Anales de Pediatría. 2021;95(6):406–412. doi:10.1016/j.anpede.2020.12.001

    27. Cole JB, Florez JC. Genetics of diabetes mellitus and diabetes complications. Nat Rev Nephrol. 2020;16(7):377–390. doi:10.1038/s41581-020-0278-5

    28. Tiret L, Poirier O, Hallet V, et al. The Lys198Asn polymorphism in the endothelin-1 gene is associated with blood pressure in overweight people. Hypertension. 1999;33(5):1169–1174. doi:10.1161/01.HYP.33.5.1169

    29. Nepal G, Ojha R, Dulal HP, Yadav BK. Association between Lys198Asn polymorphism of endothelin‐1 gene and ischemic stroke: a meta‐analysis. Brain Behav. 2019;9(10):e01424. doi:10.1002/brb3.1424

    30. Ahmed M, Rghigh A. Polymorphism in endothelin-1 gene: an overview. Current Clin Pharmacol. 2016;11(3):191–210. doi:10.2174/1574884711666160701000900

    31. Kitsios G, Zintzaras E. Genetic variation associated with ischemic heart failure: a HuGE review and meta-analysis. Am J Epidemiol. 2007;166(6):619–633. doi:10.1093/aje/kwm129

    32. Maslat AO, Al-Mahmood OM, Al Khawaja NM, Al-Shdefat R. Association of genetic polymorphisms of EDN1 gene and endothelin-1 level in patients with type 2 diabetes mellitus in the Jordanian population. Heliyon. 2024;10(1):e23676. doi:10.1016/j.heliyon.2023.e23676

    33. Ebrahimi N, Asadikaram G, Mohammadi A, Jahani Y, Moridi M, Masoumi M. The association of endothelin-1 gene polymorphism and its plasma levels with hypertension and coronary atherosclerosis. Arch Med Sci. 2019;17(3):613. doi:10.5114/aoms.2019.86770

    34. Ponasenko A, Sinitskaya A, Sinitsky M, Khutornaya M, Barbarash O. The role of polymorphism in the endothelial homeostasis and vitamin D metabolism genes in the severity of coronary artery disease. Biomedicines. 2023;11(9):2382. doi:10.3390/biomedicines11092382

    35. Choręziak-Michalak A, Szpecht D, Woźniak T, et al. Association of endothelial nitric oxide synthase (NOS3) rs2070744 variant with advanced retinopathy of prematurity: a case–control study and meta-analysis. Sci Rep. 2025;15(1):329. doi:10.1038/s41598-024-83305-7

    36. Chen T, Ma J, Shan G, Zhong Y. The polymorphisms of ATOH 7, ET-1 and ACE in non-arteritic anterior ischemic optic neuropathy. Exp Eye Res. 2018;174:147–151. doi:10.1016/j.exer.2018.05.021

    37. Barath A, Endreffy E, Bereczki C, et al. Endothelin-1 gene and endothelial nitric oxide synthase gene polymorphisms in adolescents with juvenile and obesity-associated hypertension. Acta Physiologica Hungarica. 2007;94(1–2):49–66. doi:10.1556/APhysiol.94.2007.1-2.6

    38. Treiber FA, Barbeau P, Harshfield G, et al. Endothelin-1 gene Lys198Asn polymorphism and blood pressure reactivity. Hypertension. 2003;42(4):494–499. doi:10.1161/01.HYP.0000091266.41333.15

    39. Asai T, Ohkubo T, Katsuya T, et al. Endothelin-1 gene variant associates with blood pressure in obese Japanese subjects: the Ohasama study. Hypertension. 2001;38(6):1321–1324. doi:10.1161/hy1101.095333

    40. Sadeghi MB, Nakhaee A, Saravani R, Sargazi S. Significant association of LXRβ (NR1H2) polymorphisms (rs28514894, rs2303044) with type 2 diabetes mellitus and laboratory characteristics. J Diabetes Metab Disord. 2021;20(1):261–270. doi:10.1007/s40200-021-00740-3

    41. Sargazi S, Heidari Nia M, Sargazi FM, Sheervalilou R, Saravani R, Mirinejad S. SNPs in the 3′-untranslated region of SLC30A8 confer risk of type 2 diabetes mellitus in a south-east Iranian population: evidences from case-control and bioinformatics studies. J Diabetes Metab Disord. 2020;19(2):979–988. doi:10.1007/s40200-020-00590-5

    42. Naruse M, Nakamura N, Naruse K, et al. Plasma immunoreactive endothelin levels are increased in hemodialysis patients with hypertension following erythropoietin therapy. Hypertens Res. 1992;15(1):11–16. doi:10.1291/hypres.15.11

    43. Binjawhar DN, Alhazmi AT, Bin Jawhar WN, MohammedSaeed W, Safi SZ. Hyperglycemia-induced oxidative stress and epigenetic regulation of ET-1 gene in endothelial cells. Front Genetics. 2023;14:1167773. doi:10.3389/fgene.2023.1167773

    44. Mattia GD, Cassone-Faldetta M, Bellini C, et al. Role of plasma and urinary endothelin-1 in early diabetic and hypertensive nephropathy. Am J Hypertens. 1998;11(8):983–988. doi:10.1016/S0895-7061(98)00094-6

    Continue Reading