Blog

  • Rural-urban disparities in tobacco use among middle aged and elderly Indian adults: a multivariate decomposition analysis | BMC Public Health

    Rural-urban disparities in tobacco use among middle aged and elderly Indian adults: a multivariate decomposition analysis | BMC Public Health

    Use of smoked tobacco

    Our analysis determined that tobacco was smoked by 13.10% of the middle aged and elderly individuals in India with a rural-urban absolute difference of 7.32%. Among adults aged 15 years and above, GATS 2 found the prevalence of smoked tobacco to be 10.7%. The rural-urban difference determined was 3.6% [21]. The National Non-communicable Disease Monitoring Survey (NNMS) found the prevalence of smoked tobacco to be 12.6%, with the prevalence in rural areas being 1.5% more than urban areas among individuals aged 18–69 years [32].

    In our analysis, in rural and urban areas, a higher prevalence of tobacco smokers was found among males, the elderly, Muslims, those from scheduled castes, those with less than a primary school education, those in an unskilled profession, those not living alone and North Indians. In rural areas, the highest prevalence of smoking was among the richer wealth quintiles while in urban areas, the highest prevalence was among the poorest. Previous studies too showed similar determinants of smoked tobacco use [12, 14].

    The concentration index of smoked tobacco use showed a slightly higher concentration among the lower wealth quintiles. This is in line with previous literature where the concentration indices calculated for smoked tobacco using data from the National Family Health Survey (NFHS) 5 found a higher concentration among the poor as compared to the rich [33]. A compilation of 4 rounds of NFHS data from 1998 to 2021 found the prevalence of smoked tobacco consumption to be consistently higher among the lowest wealth quintiles [12].

    The decomposition analysis of smoked tobacco showed that rural-urban differences in gender composition, educational status and caste were the determinants which contributed the most to the rural-urban difference in the prevalence of smoking. These factors contributed more to the difference in smoked tobacco, than smokeless tobacco, indicating that improving the educational status of the rural population or increasing their sex ratio would decrease the use of smoked tobacco in rural areas more than that of smokeless tobacco.

    Gender disparities in smoking can be largely attributed to the socio-cultural beliefs prevalent across India. Among men, smoking is often a communal activity, with practices such as sharing a hukkah viewed as a sign of comradery [27]. It is also perceived as a way to build social connections and is even associated with masculinity. In contrast, women who smoke often face social stigma, as smoking is considered unconventional and inappropriate for women [27, 34]. This social judgment serves as a strong deterrent for women, contributing to the gender gap in smoking prevalence. The situation is changing presently, possibly due to shifting gender roles and changing societal norms [35]. The prevalence of smoking among females has fluctuated minorly since 2005, in contrast to the steep decline among males [36]. This transition may alter the determinants of tobacco use in the future. The prevalence of smoking among rural women is considerably higher than urban women, possibly due to their lower educational status and the prevalent use of inexpensive bidis (traditional hand-rolled cigarettes) [35, 36].

    Use of smokeless tobacco

    In this analysis, the prevalence of the use of smokeless tobacco in middle aged and elderly Indians was found to be 20.43%, with the rural prevalence being 23.82%, urban prevalence being 13.03% and difference 10.79%. The NNMS determined the prevalence of use of smokeless tobacco to be 24.7%, with a rural (28.3%)-urban (17.6%) difference of almost 10% among individuals 18 to 69 years of age [32]. As per GATS-2, the prevalence of smokeless tobacco use among Indians more than 15 years of age was 21.4%, with a rural prevalence of 24.6%, an urban prevalence of 15.2% and a difference of almost 10% [21].

    In our study, the middle aged and elderly individuals with a higher prevalence of smokeless tobacco use as compared to their counterparts were males, Muslims, scheduled tribes, those from the poorer and poorest wealth indices, those with less than a primary education, Northeast Indians, and those who had no media exposure. In rural areas, those with a skilled profession and in urban areas, those with an unskilled profession had higher prevalence of tobacco use. In urban areas, smokeless tobacco use was more among the elderly. A significantly higher concentration of smokeless tobacco users was found among the poor as compared to the rich.

    An analysis of GATS 2 data of Indian women found that smokeless tobacco consumption was more among those with lesser education, those from scheduled tribes, those from the poor wealth quintiles and those from Northeast India [17]. An analysis of GATS 2 data by Nair et al. from Northeast Indian states found similar determinants [37]. A decomposition analysis of data from Northeast India found that 90% of the difference in the prevalence of smokeless tobacco use between men and women could be attributed to differences in the age, employment status, education and wealth status [37], emphasising the high contribution of socioeconomic determinants to smokeless tobacco use.

    The decomposition analysis showed that differences in the regions of domicile, occupation and education between rural and urban populations contributed the most to the difference in the prevalence of smokeless tobacco use. This re-emphasises the fact that socio-economic factors and regional cultural differences are important determinants of smokeless tobacco consumption.

    Smokeless tobacco use is socially accepted in several rural areas of India due to longstanding traditional beliefs and practices [7]. These cultural norms contribute to the wide variation in both the prevalence and types of smokeless tobacco products used across states. In certain eastern and northeastern states, its use remains deeply rooted in local customs [37], and offering betel nut with betel leaf, for instance, is regarded as a sign of hospitality [38]. In these regions, high rates of smokeless tobacco use are also observed among women and youth [17, 39]. In South India, particularly among some indigenous rural tribes, chewing tobacco holds such cultural significance that it is prioritized over food and is commonly used during weddings, festivals, funerals, and even pregnancy [7]. However, studies on tobacco-related beliefs and practices from other states are lacking, highlighting the need for further research to inform culturally tailored interventions.

    Policy implications and recommendations

    Since the prevalence of smoked and smokeless tobacco consumption was found to be higher in rural areas than urban areas, control efforts should be focussed more there, through cessation programs and strengthened law enforcement. To address the varying prevalence of tobacco use across different states in the country, we propose differential taxing by states, as well as a more decentralized tobacco cessation program design and implementation at the state or regional level. Social and behaviour change communication should be strengthened to address the socio-cultural factors of tobacco use.

    In line with previous literature [13], our results emphasise the importance of focussing on the underlying inequities which contribute to differential tobacco consumption. Improving the educational status of the rural population could decrease the difference in the prevalence of smoked tobacco consumption by 41% and smokeless tobacco by 20%. Given the significant negative concentration index, tobacco cessation activities should target poorer wealth quintiles.

    The distinct cultural habits and beliefs which have led to regional variations in smokeless tobacco consumption should be explored using qualitative research methods and addressed on an individual basis.

    Strengths and limitations

    To the best of our knowledge, this is the first study which could be found which delineated the factors contributing to the difference in the rural-urban prevalence of smoked and smokeless tobacco consumption among middle aged and elderly adults in India. The results are generalisable to the population aged 45 years and above in India, given the nationally representative sample included and the appropriate sample weights used.

    However, this study has some limitations as well. Given the cross-sectional nature of the primary data-set, temporality could not be determined and there is a chance of reverse-causality. Bonferroni correction was not used while determining the factors associated with tobacco use. Since the data collected was self-reported, there may be underreporting of tobacco use because of social desirability bias. Additional factors which could potentially influence tobacco use, such as knowledge about the toxic effects of tobacco, were not determined for this analysis. The sample chosen for this analysis was middle aged and elderly Indians, due to the lack of data openly available for the entire adult population, which would have made the results more generalisable.

    Continue Reading

  • Oxygen-Breathing Crystal May Enable Better Electronics

    Oxygen-Breathing Crystal May Enable Better Electronics


    Register for free to listen to this article

    Thank you. Listen to this article using the player above. ✖


    Want to listen to this article for FREE?


    Complete the form below to unlock access to ALL audio articles.

    A team of scientists from Korea and Japan has discovered a new type of crystal that can “breathe”—releasing and absorbing oxygen repeatedly at relatively low temperatures. This unique ability could transform the way we develop clean energy technologies, including fuel cells, energy-saving windows, and smart thermal devices.

    The newly developed material is a special kind of metal oxide made of strontium, iron, and cobalt. What makes it extraordinary is that it can release oxygen when heated in a simple gas environment and then take it back in, all without falling apart. This process can be repeated many times, making it ideal for real-world applications.

    This remarkable study has been led by Professor Hyoungjeen Jeen from the Department of Physics, Pusan National University, Korea, and co-authored by Professor Hiromichi Ohta from the Research Institute for Electronic Science, Hokkaido University, Japan. Their findings have been published in the journal Nature Communications on August 15, 2025.

    “It is like giving the crystal lungs and it can inhale and exhale oxygen on command,” says Prof. Jeen. Controlling oxygen in materials is crucial for technologies like solid oxide fuel cells, which produce electricity from hydrogen with minimal emissions. It also plays a role in thermal transistors—devices that can direct heat like electrical switches—and in smart windows that adjust their heat flow depending on the weather.

    Until now, most materials that could do this kind of oxygen control were too fragile or operated only at the harsh conditions like extremely high temperatures. This new material works under milder conditions and remains stable.

    “This finding is striking in two ways: only cobalt ions are reduced, and the process leads to the formation of an entirely new but stable crystal structure,” explains Prof. Jeen.

    They also showed that the material could return to its original form when oxygen was reintroduced, proving that the process is fully reversible. “This is a major step towards the realization of smart materials that can adjust themselves in real time,” says Prof. Ohta. “The potential applications range from clean energy to electronics and even eco-friendly building materials.”

    Reference: Lee J, Seo YS, Pitike KC, et al. Selective reduction in epitaxial SrFe0.5Co0.5O2.5 and its reversibility. Nat Commun. 2025;16(1):7391. doi: 10.1038/s41467-025-62612-1

    This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source. Our press release publishing policy can be accessed here.

    Continue Reading

  • Atypical presentation of Blastocystis-related dysentery in an HIV-infe

    Atypical presentation of Blastocystis-related dysentery in an HIV-infe

    Introduction

    Blastocystis hominis (B. hominis) is an intestinal protozoan parasite frequently identified in humans and a variety of animals.1,2 It is estimated that one billion of the world population harbours Blastocystis sp. although the prevalence of B. hominis varies significantly depending on population demographics and geographical location, with higher rates reported in regions with inadequate sanitation.3,4 Most infections are asymptomatic though occasionally it can cause gastrointestinal symptoms such as diarrhea, abdominal discomfort, and nausea.5

    In individuals with compromised immune responses, such as those infected with the Human Immunodeficiency Virus (HIV), the risk of opportunistic infections is markedly increased.6 Despite not being categorized as a classical opportunistic infectious agent, B. hominis may behave opportunistically in patients with impaired immune systems due to increased potentials of colonization and symptom development.6–8 Nevertheless, it is still unclear how exactly B. hominis infection affects the course of HIV and its treatment efficacies.

    Conventional diagnostic methods for B. hominis using microscopic examination of stained stool samples often lack the sensitivity and specificity required for accurate detection. To this end, quantitative Polymerase Chain Reaction (qPCR) has emerged as a superior diagnostic technique, offering heightened accuracy in identifying parasitic infections, including those caused by B. hominis.9

    This case report presents atypical presentation of Blastocystis-related dysentery in an HIV-infected patient, emphasizing the efficacy of qPCR for rapid and accurate confirmation of this parasite’s diagnosis. It also describes the response to combination therapies. This report highlights the critical role of advanced diagnostic techniques in the management of infections in immunocompromised individuals.

    Case Description

    A 20-year-old male was admitted to the outpatient clinic of Dr Saiful Anwar General Hospital in Malang, East Java, Indonesia, with a complaint of diarrhea about seven times per day which was experienced for the past four days. The diarrhea contained blood and mucus and was accompanied by stomach ache and nausea, with no vomiting. He also experienced fever for the past two weeks which co-existed with coughing and shortness of breath. There was a painless enlargement of the cervical gland on the left side due to cervical lymphadenopathy. The patient also suffered general malaise, which left him feeling of discomfort, illness, or fatigue. His appetite decreased, leading to significant weight loss. His skin was dry and itchy, and rashes appeared on his hands, feet, and almost all over the body surface.

    As immunosuppression was suspected, the patient was subjected to HIV testing using three HIV rapid tests, including ViroCheck HIV ½ (RV-H25A, PT Indec Diagnostic, Indonesia), d3TEKS1 HIV 1/2 Antibody Rapid Test (PT Merah Putih Manufaktura, Indonesia), and Arkan Medical One Step Anti-HIV (1/2) and Syphilis Test Combo (PT Arkanindoplast Utama, Indonesia), all of which showed positive results. The CD4+ count was down to 78 cells/µL. These results ensuring that diagnosis HIV is established.

    Further laboratory investigations, including routine blood tests, serology of Toxoplasma gondii (ECLIA, Elecsys Toxo IgG.07028008501.V4.en; Elecsys Toxo IgM.07028024501.V4.en), Cytomegalovirus/CMV (ECLIA, Elecsys CMV IgG.07027117500.V4.en; Elecsys CMV IgM.07027133501.V2.en) and HBsAg (ECLIA, Elecsys HBsAg II.08814848500.V5.en), failed to identify any common pathogens. Given the patient’s immunocompromised status, a more comprehensive parasitological examination was conducted. Stool samples were collected and prepared using direct smear, Giemsa, and Trichrome stain. Microscopic examination using direct smear identified amoeboid form of protozoa which showed prominent, extended pseudopodia of varying shape, while Giemsa and Trichrome stained samples showed cells containing large central bodies (vacuoles), with thin bands of cytoplasm around and the cells appearing to have “beaded rim”. The protozoa appearances were abundantly identified using microscopic examination, with more than five forms per high powered fields observed (Figure 1).

    Figure 1 Amoeboid, granular, and vacuolar-like protozoan’s form on (A) Giemsa staining and (B) Trichrome staining.

    To further investigate the protozoan species, the DNA extraction was performed from his stool samples using (QIAamp DNA Mini Kit, Qiagen, Hilden, Germany). Following this, quantitative polymerase chain reaction (qPCR) was performed to target Giardia intestinalis, Entamoeba histolytica, Cryptosporidium spp., and Dientamoeba fragilis as previously published. An additional detection targeting Blastocystis hominis was performed using primers 5′- CCTGAGAGATGGCTACCACATCC −3′ and 5′- ATAGTCCCGCATTGTGATTTATTGT −3′, and a Quasar 705-based probe (5′- CGCGTAAATCACCCAATCCTGACACA −3′). The qPCR setup and cycles were performed according to the previously described protocol.10 The cycle threshold (Ct) was analyzed using CFX Maestro Software (Bio-Rad Laboratories, Inc., Singapore). The qPCR analysis revealed the presence of B. hominis DNA, with a Ct value of 40.29 (Figure 2).

    Figure 2 The rt-PCR detection of Blastocystis hominis.

    Both microscopy and molecular examinations confirmed the presence of B. hominis in the stool sample of the outpatient. The two positive methods for Blastocystis (microscopy and qPCR), showed a much stronger association. Thus, our results established a diagnosis of Blastocystosis for the patient. This result is significant considering the rarity of symptomatic B. hominis infection.

    The patient was then treated with cotrimoxazole 960 mg twice a day and metronidazole 750 mg three times daily for ten days in addition to antiretroviral (ARV) treatment. The ARV prescribed for the patient using the combination of tenofovir 300 mg, lamivudine 300 mg, and dolutegravir 50 mg, per day. After the course of anti-parasitic treatment and ARV, the patient experienced a marked improvement of symptoms. Follow-up microscopic stool examination five days post-treatment showed negative result for B. hominis identification, and the patient reported a complete resolution of gastrointestinal symptoms after ten days.

    Discussion

    Blastocystis hominis is an intestinal protozoan parasite that is often overlooked due to its generally asymptomatic nature. Occasionally, it can cause gastrointestinal symptoms, particularly in immunocompromised patients5,11 The case of a B. hominis infection in an HIV-infected patient, as described in this report, underscores several important considerations in the diagnosis and management of such infections.

    This case is notable because of the atypical Blastocystis-related dysentery, as opposed to the commonly asymptomatic feature, found in an HIV-infected patient. Previous study on HIV patients have reported the presence of B. hominis in stool samples without clinical symptoms.12 However, there were others who reported gastrointestinal symptoms related to B. hominis infection, which contribute in accelerating the progression of HIV/AIDS.13,14

    Although mostly asymptomatic, B. hominis infection may cause a range of clinical symptoms, including diarrhea, nausea, vomiting, stomach ache, flatulence, tenesmus, constipation, anorexia, weight loss, lethargy, fever, chills, dehydration, and insomnia. In this case, the patient experienced bloody and mucous diarrhea, with faecal leucocytosis, which was potentially caused by the amoeboid form of the parasite. It has been postulated that amoeboid forms of B. hominis contributed to Blastocystis pathology due to their capacity to adhere to intestinal epithelial cells.15 Other report demonstrated that vacuolar forms of Blastocystis sp. can reach the lamina propria, submucosa, and muscle layers in mice infected orally with this parasite.16

    The other possibility of dysentery in this case was due to co-infection of Blastocystis with other pathogens, especially bacteria. Gastrointestinal symptoms, including abdominal discomfort, loss of appetite, and relative eosinophilia, were reportedly linked to Blastocystis sp. and pathogenic bacteria co-infection.17 In this case, the patient was screened for common intestinal parasites, however this does not rule out the possibility of bacteria or microsporidia infection. Previous study was revealed that B. hominis was positively associated with Campylobacter jejuni (C. jejuni)/Escherichia coli (E. coli), Giardia spp., Enterotoxigenic E. coli (ETEC), Enteropathogenic E. coli (EPEC), Shigella/Entero-invasive E. coli (EIEC), and Cryptosporidium spp. infection.18

    Thus far, microscopic examination of stool samples is the gold standard and the most common method used in detecting intestinal parasites, particularly in Indonesia. This method is also beneficial for the identification of other findings including white blood cells, Charcot-Leyden crystals, etc.19 In addition, this conventional diagnostic method is useful to differentiate four distinct morphological forms of B. hominis, including vacuolar, granular, amoeboid, and cyst. However, microscopy is frequently reported to have low sensitivity and specificity, which may lead to potential misdiagnosis of B. hominis.4 In this case, we observed around 7–15 parasites per field of view. The amoeboid, vacuolar, and granular forms of the protozoa are clearly identifiable using conventional microscopy, but the parasite species was unable to be confirmed due to morphological similarity of the amoeboid form with that of Entamoeba.

    The use of qPCR proved to be pivotal in accurately identifying B. hominis, demonstrating higher sensitivity and specificity of molecular techniques compared to traditional methods5,16 The excellent performance of PCR compared to other diagnostic tools lies in its capability to detect low amount of parasite DNAs. Previous research has shown that PCR-based diagnostic approaches are more effective and sensitive for detecting B. hominis, with qPCR being the most sensitive. In this case, the qPCR identifies the parasite’s small subunit rRNA (SSU-rDNA) gene.4 In the future, further determination of Blastocystis subtypes in the sample using specific PCR primers or DNA sequencing methods could also provide important information on the molecular epidemiology and pathogenic potential of this parasite.

    This case illustrates the need for advanced diagnostic techniques in clinical settings, especially for immunocompromised patients who may present atypical manifestations. Moreover, this case prompts further discussion about the role of routine qPCR screening for gastrointestinal pathogens in HIV-infected patients presenting with persistent gastrointestinal symptoms. While qPCR may not be universally available or cost-effective in all settings, its targeted use in specific cases could improve diagnostic accuracy and patient outcomes.

    The successful treatment of the patient with cotrimoxazole and metronidazole, following accurate diagnosis using qPCR, led to the resolution of symptoms, elimination of parasites, and emphasizing the importance of accurate and timely diagnosis in guiding appropriate treatment.20–22

    Conclusion

    In conclusion, Blastocystis hominis is a poorly understood intestinal protozoan, with continuously debatable properties of its pathogenicity. The occurrence of atypical Blastocystis-related dysentery in an HIV-infected patient and the successful use of qPCR for its diagnosis highlight critical aspects of managing parasitic infections in immunocompromised individuals. The integration of advanced molecular diagnostics into routine clinical practice can significantly enhance the detection and treatment of such infections, ultimately improving patient care leading to effective treatment and improved patient outcomes, particularly in immunocompromised individuals.

    Informed Consent for Publication

    Written consent for publication of case details was obtained from the patient. Institutional approval to publish the case details has been obtained from the Health Research Ethics Commission of the Faculty of Medicine Universitas Brawijaya (Approved on August 8, 2023, with the approval number 253/EC/KEPK/08/2023).

    Acknowledgments

    The authors would like to acknowledge to the patient for his willingness and Faculty of Medicine Universitas Brawijaya, Malang, Indonesia, for supporting this study.

    Funding

    This research received funding by a grant from the Faculty of Medicine, Universitas Brawijaya, Malang, Indonesia (grant number: 3173.2/2/UN10.F08/PN/2023).

    Disclosure

    The authors report no conflicts of interest in this work.

    References

    1. Naguib D, Gantois N, Desramaut J, et al. Molecular epidemiology and genetic diversity of the enteric protozoan parasite Blastocystis sp. in the Northern Egypt population. Pathogens. 2023;12(11):1359. doi:10.3390/pathogens12111359

    2. Naguib D, Gantois N, Desramaut J, et al. Large-scale molecular epidemiological survey of blastocystis sp. among herbivores in Egypt and assessment of potential zoonotic risk. Microorganisms. 2024;12(7):1286. doi:10.3390/microorganisms12071286

    3. Rudzińska M, Sikorska K. Epidemiology of Blastocystis Infection: a Review of Data from Poland in Relation to Other Reports. Pathogens. 2023;12(8):1050. doi:10.3390/pathogens12081050

    4. Alamin U. Worldwide epidemiological study of Blastocystis subtypes in humans. A systematic review and meta-analysis. Thesis for MSc in infectious diseases. School of Biosciences University of Kent; 2023.

    5. Stensvold CR, Clark CG. Current status of Blastocystis: a personal view. Parasitol Int. 2016;65(6 Pt B):763–771. doi:10.1016/j.parint.2016.05.015

    6. Zhang SX, Wang JC, Li ZW, et al. Impact factors of Blastocystis hominis infection in persons living with human immunodeficiency virus: a large-scale, multi-center observational study from China. Infect Dis Poverty. 2023;12(1):82. doi:10.1186/s40249-023-01137-5

    7. Chandramathi S, Suresh K, Sivanandam S, Kuppusamy UR. Stress exacerbates infectivity and pathogenicity of blastocystis hominis: In Vitro and in vivo evidences. PLoS One. 2014;9(5):e94567. doi:10.1371/journal.pone.0094567

    8. Abdellatif MZM, Abdel-Hafeez EH, Belal US, et al. Detection of blastocystis species in immunocompromised patients (cancer, diabetes mellitus, and chronic renal diseases) by restriction fragment length polymorphism (RFLP). Beni-Suef Univ J Basic Appl Sci. 2025;14:42. doi:10.1186/s43088-025-00631-z

    9. Roberts T, Barratt J, Harkness J, Ellis J, Stark D. Comparison of microscopy, culture, and conventional polymerase chain reaction for detection of Blastocystis sp. in clinical stool samples. Am J Trop Med Hyg. 2011;84(2):308–312. doi:10.4269/ajtmh.2011.10-0447

    10. Kaisar MMM, Brienen EAT, Djuardi Y, et al. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology. 2017;144(7):965–974. doi:10.1017/s0031182017000129

    11. Surja SS, Kristin H, Hangestu A, et al. Common intestinal parasitic infections in an improved water access, sanitation, and hygiene profile setting in North Jakarta, Indonesia. Narra J. 2024;4(3):e1264. doi:10.52225/narra.v4i3.1264

    12. Albrecht H, Stellbrink HJ, Koperski K, Greten H. Blastocystis hominis in human immunodeficiency virus-related diarrhea. Scand J Gastroenterol. 1995;30(9):909–914. doi:10.3109/00365529509101600

    13. Ning CQ, Hu ZH, Chen JH, Ai L, Tian LG. Epidemiology of Blastocystis infection from 1990 to 2019 in China. Infect Dis Poverty. 2020;9(1):168. doi:10.1186/s40249-020-00779-z

    14. Mayer KH, Karp CL, Auwaerter PG, Mayer KH. Coinfection with HIV and tropical infectious diseases. II. Helminthic, fungal, bacterial, and viral pathogens. Clin Infect Dis. 2007;45(9):1214–1220. doi:10.1086/522180

    15. Vielma JR. Blastocystosis: epidemiological, clinical, pathogenic, diagnostic, and therapeutic aspects // Blastocistosis: aspectos epidemiológicos, clínicos, patogénicos, diagnósticos y terapéuticos. Investigación Clínica. 2020;60(1):53–78. doi:10.22209/IC.v60n1a06

    16. Zhou YL, Zhao N, Yang Y, et al. Molecular identification and subtype analysis of Blastocystis in captive asiatic black bears (Ursus thibetanus) in China’s Heilongjiang and Fujian provinces. Front Cell Infect Microbiol. 2022;12:993312. doi:10.3389/fcimb.2022.993312

    17. Matovelle C, Tejedor MT, Monteagudo LV, Beltrán A, Quílez J. Prevalence and Associated Factors of Blastocystis sp. Infection in Patients with Gastrointestinal Symptoms in Spain: A Case-Control Study. Trop Med Infect Dis. 2022;7(9):226. doi:10.3390/tropicalmed7090226

    18. Zaman Wahid B, Haque MA, Gazi MA, et al. Site-specific incidence rate of Blastocystis hominis and its association with childhood malnutrition: findings from a multi-country birth cohort study. Am J Trop Med Hyg. 2023;108(5):887–894. doi:10.4269/ajtmh.22-0662

    19. Stubbe C, Powell L. Parasitology Stool Diagnostic From Basics to Blastocystis. Asheville, NC: Genova Diagnostics 2019;1–61. Available from: https://www.gdx.net/files/livegdx/2019/parasitology-stool-diagnostics-from-basics-to-blastocystis-july-livegdx.pdf.

    20. CDC. Clinical care of blastocystosis. 2024. Available from: https://www.cdc.gov/blastocystis/hcp/clinical-care/index.html. Accessed July 17, 2025.

    21. Rajamanikam A, Hooi HS, Kudva M, Samudi C, Kumar S. Resistance towards metronidazole in Blastocystis sp.: a pathogenic consequence. PLoS One. 2019;14(2):e0212542. doi:10.1371/journal.pone.0212542

    22. Roberts T, Bush S, Ellis J, Harkness J, Stark D. In vitro antimicrobial susceptibility patterns of Blastocystis. Antimicrob Agents Chemother. 2015;59(8):4417–4423. doi:10.1128/AAC.04832-14

    Continue Reading

  • Iran says new round of IAEA talks likely, open to steps if sanctions lifted

    Iran says new round of IAEA talks likely, open to steps if sanctions lifted

    Continue Reading

  • Embryo Implantation Captured in 3D for First Time

    Embryo Implantation Captured in 3D for First Time


    Register for free to listen to this article

    Thank you. Listen to this article using the player above. ✖


    Want to listen to this article for FREE?


    Complete the form below to unlock access to ALL audio articles.

    Researchers at the Institute for Bioengineering of Catalonia (IBEC) have recorded human embryo implantation in real time for the first time, using an innovative system developed in the laboratory that simulates the outer layers of the uterus in 3D. Implantation failure is one of the main causes of infertility, accounting for 60% of miscarriages. The work, published in the journal Science Advances, may help to better understand the mechanisms underlying the implantation process, improving fertility rates and optimising assisted reproduction processes.

    Researchers at the Institute for Bioengineering of Catalonia (IBEC) in collaboration with Reproductive Medicine Department at Dexeus Mujer–Hospital Universitari Dexeus have captured unparalleled images of a human embryo implanting. This is the first time that the process has been recorded in real time and in 3D.

    Failure of the implantation process in the uterus is one of the main causes of infertility, accounting for 60% of spontaneous abortions. Until now, it had not been possible to observe this process in humans in real time, and the limited available information came from still images taken at specific moments during the process.

    “We have observed that human embryos burrow into the uterus, exerting considerable force during the process. These forces are necessary because the embryos must be able to invade the uterine tissue, becoming completely integrated with it. It is a surprisingly invasive process. Although it is known that many women experience abdominal pain and slight bleeding during implantation, the process itself had never been observed before,” explains Samuel Ojosnegros, principal investigator of the IBEC’s Bioengineering for Reproductive Health group and leader of the study.

    To advance during implantation, the embryo releases enzymes that break down the surrounding tissue. However, it is also known that force is required in order to penetrate the underlying layers of the uterus. This fibrous tissue is filled with collagen, a rigid protein that also forms tendons and cartilage. “The embryo opens a path through this structure and begins to form specialised tissues that connect to the mother’s blood vessels in order to feed,” adds Ojosnegros.

    The research team’s results reveal that human embryos exert traction forces on their environment, remodelling it. “We observe that the embryo pulls on the uterine matrix, moving and reorganising it. It also reacts to external force cues. We hypothesise that contractions occurring in vivo may influence embryo implantation,” explains Amélie Godeau, a researcher in the Ojosnegros group and co-first author of the study. Thus, effective embryo invasion is associated with optimal matrix displacement, highlighting the importance of these forces in the implantation process.

    Improving our understanding of the implantation process could have a significant impact on fertility rates, embryo quality and the time taken to conceive through assisted reproduction.

    A platform for studying implantation in the laboratory

    To carry out the study, the IBEC research team developed a platform that allows embryos to implant outside the uterus under controlled conditions. This enables real-time fluorescence imaging and analysis of the embryo’s mechanical interactions with its environment. The platform is based on a gel composed of an artificial matrix formed by collagen, which is abundant in uterine tissue, and various proteins necessary for embryo development.

    Experiments were carried out with both human and mouse embryos to allow comparison of the two implantation processes. When the mouse embryo comes into contact with the uterus, it exerts forces to adhere to its surface. The uterus then adapts by folding around the embryo, enveloping it in a uterine crypt. In contrast, the human embryo moves inward and penetrates the uterine tissues completely. Once there, it begins to grow radially from the inside out.

    “Our platform has enabled us to quantify the dynamics of embryo implantation and determine the mechanical footprint of the forces used in this complex process in real time,” concludes Anna Seriola, IBEC researcher and co-first author of the study.

    “Our work has involved providing technical advice and carrying out a rigorous selection of the human embryos donated for research, with the aim of ensuring they met the ideal conditions for the execution of the project,” explains Miquel Solé, director of the Laboratory of Criopreservation of Dexeus Mujer.

    Reference: Godeau AL, Seriola A, Tchaicheeyan O, et al. Traction force and mechanosensitivity mediate species-specific implantation patterns in human and mouse embryos. Sci Adv. 2025;11(33):eadr5199. doi: 10.1126/sciadv.adr5199

    This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source. Our press release publishing policy can be accessed here.

    Continue Reading

  • Today in video games – 18th August: Gamescom week and the games you’re looking forward to in September

    Today in video games – 18th August: Gamescom week and the games you’re looking forward to in September

    It’s 15th August, and we’re back with another daily live report. We’ll be running down all the day’s news and events, checking in with what you are up to, and providing some hopefully entertaining commentary on the world of video games.

    Today we’ve got some great articles going live on the site, but we’ll also discuss Gamescom, which takes place this week, and look at the games releasing in September that you’ve got your eyes on.

    Continue Reading

  • Myanmar’s massive quake hints at bigger earthquakes to come

    Myanmar’s massive quake hints at bigger earthquakes to come

    On March 28, 2025, a magnitude 7.7 earthquake struck the Southeast Asia country of Myanmar along the Sagaing Fault, killing thousands and causing widespread damage. A new study from Caltech uses satellite imaging of the Sagaing Fault’s motion to improve models of how such faults may behave in the future. The study indicates that strike-slip faults, like the Sagaing and the San Andreas, may be capable of earthquakes that are significantly different from past known earthquakes and potentially much larger.

    The research was conducted primarily in the laboratory of Jean-Philippe Avouac, the Earle C. Anthony Professor of Geology and Mechanical and Civil Engineering and director of the Center for Geomechanics and the Mitigation of Geohazards. Postdoctoral scholar Solène Antoine is the study’s first author. The study is described in a paper appearing in the journal Proceedings of the National Academy of Sciences on August 11.

    The Sagaing fault runs in a relatively straight north-to-south line throughout Myanmar. As its two sides slowly move against one another in opposite directions, stress accumulates along the fault. When the stress buildup reaches a breaking point, the fault slips rapidly, causing an earthquake. The Sagaing and San Andreas faults are very similar — both relatively straight strike-slip faults running hundreds of kilometers — and the 2025 Myanmar earthquake, therefore, sheds light on possible future earthquakes on the San Andreas fault.

    “This earthquake turned out to be an ideal case to apply image correlation methods [techniques to compare images before and after a geological event] that were developed by our research group,” Antoine says. “They allow us to measure ground displacements at the fault, where the alternative method, radar interferometry, is blind due to phenomenon like decorrelation [a process to decouple signals] and limited sensitivity to north-south displacements.”

    Based on studies of historic earthquakes along the Sagaing fault, researchers anticipated that a large earthquake would occur on a 300-kilometer section where no large earthquakes had occurred since 1839. This theory is known as the seismic gap hypothesis: Stuck sections of a fault where there has not been movement are expected to slip to “catch up.” While this section did indeed rupture during the 2025 quake, the fault actually slipped along a total of more than 500 kilometers, indicating that the fault did indeed make up the deficit of slip and more.

    In the new study, the team used correlation of satellite optical and radar imagery of the fault — a technique originally developed in the Avouac laboratory and now widely used in seismology — and its surroundings to determine that the 500-kilometer section shifted a net of 3 meters after the quake, that is, the eastern side moved south by 3 meters relative to the western side.

    Current models used for seismic hazard assessment are mostly based on earthquake statistics and are time independent, meaning they can only give probabilities of an earthquake during a chosen timespan. For example, these models might estimate, for any given 30-year period and particular area, the probability that an earthquake would exceed a chosen magnitude. However, in order to make truly informed estimates of potential seismic hazards for specific time periods — say, the next 30 years — it is crucial for models to take into account how recently a fault has slipped, where the slip occurred, and by how much.

    “The study shows that future earthquakes might not simply repeat past known earthquakes,” Avouac says. “Successive ruptures of a given fault, even as simple as the Sagaing or the San Andreas faults, can be very different and can release even more than the deficit of slip since the last event. In addition, historical records are generally far too short for statistical models to represent the full range of possible earthquakes and eventual patterns in earthquake recurrence. Physics-based models provide an alternative approach with the advantage that they could, in principle, be tuned to observations and used for time-dependent forecast.”

    The paper is titled “The 2025 Mw7.7 Mandalay, Myanmar, earthquake reveals complex earthquake cycle with clustering and variable segmentation on Sagaing fault.” In addition to Antoine and Avouac, Caltech co-authors are graduate student Rajani Shrestha, postdoctoral scholar Chris Milliner, and senior research scientist Kyungjae Im. Additional co-authors are Chris Rollins (PhD ’18) of GNS Science Te Pu Ao in New Zealand, Kang Wang of EarthScope Consortium Inc., and Kejie Chen of Southern University of Science and Technology in China. Funding was provided by the Center for Geomechanics and Mitigation of Geohazards, the Statewide California Earthquake Center, the National Science Foundation, and the US Geological Survey.

    Continue Reading

  • Australia bans far-right MK Rothman hours before trip, sparking Israeli backlash

    Australia bans far-right MK Rothman hours before trip, sparking Israeli backlash

    Australia barred far-right Religious Zionism MK Simcha Rothman from visiting the country for a series of appearances, Home Affairs Minister Tony Burke said Monday, accusing the politician of intending to “spread division.”

    Israel later responded in anger, revoking the residency visas of Australia’s representatives to the Palestinian Authority and implementing other steps.

    Rothman, a far-right lawmaker, had been slated to make a series of appearances at Jewish schools and synagogues and meet with victims of a recent wave of antisemitic attacks, according to the Australian Jewish Association, which invited him and confirmed that Rothman’s visa had been cancelled.

    “If you are coming to Australia to spread a message of hate and division, we don’t want you here,” Burke said. “Australia will be a country where everyone can be safe, and feel safe.”

    As an automatic condition of the visa cancellation, Rothman is unable to travel to Australia for three years.

    It was unclear which, if any, specific actions or comments by Rothman had triggered the move by Canberra.

    However, in a statement, Rothman said the decision was “a surrender to terrorism and antisemitism that is rampant on the streets of Australia,” and had been made due to the Knesset’s vote last month to pass a motion in favor of annexing the West Bank, a symbolic move by the parliament that is non-binding.

    Australia’s Home Affairs Minister Tony Burke attends a press conference in Jakarta on December 3, 2024 (BAY ISMOYO / AFP)

    He also said that he had been invited to speak as his views “reflect the mainstream of Israeli society: that Hamas has shown that Israel must defeat it, and that a Palestinian state poses a danger to the existence of the State of Israel.”

    Rothman claimed in an interview with the Kan public broadcaster on Monday that the Australian government was “threatened by Islamist jihadists about what will happen if I am allowed to visit, and so instead of worrying about public order, instead of standing firm against terror, they surrendered to terror.”

    According to the AJA, the visa was canceled hours before Rothman was slated to fly to Australia.

    “This is a viciously antisemitic move from a government that is obsessed with targeting the Jewish community and Israel,” AJA head Robert Gregory said in a statement posted online by the group, which describes itself as a center-right organization.

    Gregory said Jews should think twice before visiting Australia, claiming that increasing numbers of Australian Jews are looking into emigrating.

    “Israel is fully justified in taking strong measures in response to this, and we have briefed contacts in the Trump Administration who are also concerned about events in Australia,” he added.

    Australia’s Prime Minister Anthony Albanese (C) and members of the local Jewish community visiting the torched Adass Israel Synagogue in Melbourne on December 10, 2024. (DEPARTMENT OF PRIME MINISTER AND CABINET / AFP)

    Hours after the announcement, Foreign Minister Gideon Sa’ar decided to revoke the residency visas of Australia’s representatives to the Palestinian Authority, according to a statement from his spokesperson.

    In addition, Sa’ar instructed Israel’s embassy in Canberra “to carefully examine every official Australian visa request for entry into Israel,” the statement added.

    Foreign Minister Gideon Sa’ar addresses a joint press conference with his Lithuanian counterpart at the Foreign Ministry in Vilnius on July 1, 2025. (Petras Malukas / AFP)

    The decisions, which were presented to the Australian ambassador a short while ago, “come in response to Australia’s decisions to recognize a ‘Palestinian state’” in September, as well as its refusal earlier today, “without any justification, to grant entry visas to a series of Israeli figures, among them former Justice Minister Ayelet Shaked and Knesset Constitution, Law and Justice Committee chairman MK Simcha Rothman,” the statement continued.

    “At a time when antisemitism in Australia is running rampant — including incidents of violence against Jews and Jewish institutions — the Australian government has chosen to inflame it further, by falsely claiming that visits by Israeli figures would disturb public order and harm Australia’s Muslim population,” Sa’ar added in the statement.

    Coalition condemnation

    Far-right National Security Minister Itamar Ben Gvir condemned Australia’s decision on X, calling it “a historical stain and a shame for the Australian government” and criticizing what he calls “the gloating cries of Israeli left-wing activists, the collaborators of Hamas, and those who defame Israel worldwide.”

    Diaspora Affairs Minister Amichai Chikli, also in a post on X in English, argued that barring Rothman from entry is “a direct extension of [Australia’s] disgraceful choice to honor the rapists and murderers of Hamas,” reflecting “a broken moral compass, discrimination, and a grave assault on free speech.”

    He warned that Prime Minister Anthony Albanese is “wrong to think appeasement of Islamist terror will advance Australia” and said such policies risk following “Britain’s disastrous path.” It was unclear exactly what Chikli was referring to with regards to the UK.

    Rothman, who heads the Knesset’s Constitution, Law and Justice Committee, is one of the architects of the controversial overhaul of the judicial system being pushed by the Israeli government.

    He is a member of Finance Minister Bezalel Smotrich’s far-right Religious Zionism party. In June, Smotrich and Ben Gvir were both sanctioned by Australia, alongside the UK, Canada, New Zealand and Norway, for having “incited extremist violence” against Palestinians in the West Bank.

    Smotrich openly calls for the resettlement of Gaza and said in May that Israel will not withdraw from the Strip even if there is another hostage deal, telling Israelis to embrace the word “occupation.”

    Finance Minister Bezalel Smotrich and Knesset Constitution, Law and Justice Committee Chairman MK Simcha Rothman hold a press conference in the Knesset, March 21, 2023. (Yonatan Sindel/Flash90)

    Canberra has taken an increasingly critical stance toward Israel in recent weeks, including announcing plans to recognize a Palestinian state next month, alongside a number of other Western nations.

    There are also tensions between the government and Australia’s Jewish community amid a wave of antisemitic attacks.

    In June, Australia barred pro-Israel activist and influencer Hillel Fuld because his presence would constitute a risk to “health, safety or good order,” Burke’s office said at the time.

    Last year, it blocked former justice minister Ayelet Shaked for similar reasons.

    In July, Canberra canceled US rapper Kanye West’s visa over his song glorifying Nazi leader Adolf Hitler.

    Ariela Karmel contributed to this report.


    Continue Reading

  • Wallabies welcome Nerimoff as official vodka partner

    Wallabies welcome Nerimoff as official vodka partner

    Rugby Australia is proud to announce the expansion of its partnership with Nemiroff, the award-winning Ukrainian vodka brand, as the official vodka partner of the Wallabies.

    The multi-year partnership unlocks a wide array of premium rights and activations, designed to offer high-impact brand visibility and deepen the connection between Nemiroff and Australia’s passionate rugby supporters.

    From digital channels to stadium experiences, the collaboration is built to resonate strongly with consumers and bring the bold Ukrainian spirit to life on and off the field.

    The landmark agreement follows Nemiroff’s recent partnership with the Wallaroos, marking a bold step forward in the brand’s expansion into the Australian market.

    Known for its heritage dating back over 150 years and its uncompromising commitment to quality, Nemiroff was recently named Vodka Brand Champion 2025 and Supreme Brand Champion 2025 — the first vodka brand in history to earn the top distinction across all spirits categories.

    Rugby Australia CEO Phil Waugh said: “We’re excited to extend our relationship with Nemiroff as they join the Wallabies family.

    “Their global standing, commitment to the highest standards, and passion for performance align seemlessly with the Wallabies’ values.

    “With a golden decade here for Australian rugby, we look forward to delivering unforgettable experiences for our supporters through this unique partnership.”

    Nemiroff CEO Yuriy Sorochynskiy said: “Joining forces with the Wallabies is a powerful next step in our journey with Australian rugby.

    “This team reflects the values we hold close: strength, pride, and an unwavering will to win.

    “For us, this partnership is about building meaningful fan experiences and celebrating the spirit of sport together with a nation that knows how to rise to the challenge.”

    2025 Wallabies Tests (all dates and times are AEST)

    Wallabies 21 defeated Fiji 18 on Sunday July 6 at McDonald Jones Stadium, Newcastle

    Qatar Airways British & Irish Lions Tour

    Wallabies 19 defeated by the British & Irish Lions 27 on Saturday July 19 at Suncorp Stadium, Brisbane

    Wallabies 26 defeated by the British & Irish Lions 29 on Saturday July 26 at Melbourne Cricket Ground, Melbourne

    Wallabies 22 defeated the British & Irish Lions 12 on Saturday August 2 at Accor Stadium, Sydney

    The Flight Centre Rugby Championship/Bledisloe Cup

    Wallabies 38 defeated South Africa 22 on Saturday August 16 at Emirates Airline Park, Johannesburg

    Wallabies v South Africa at 1:10am AEST on Sunday August 24 at DHL Stadium, Cape Town

    Wallabies v Argentina at 2:30pm AEST on Saturday September 6 at Queensland Country Bank Stadium, Townsville

    Wallabies v Argentina at 2:00pm AEST on Saturday September 13 at Allianz Stadium, Sydney

    Wallabies v New Zealand at 3:05pm AEST on Saturday September 27, Eden Park, Auckland

    Wallabies v New Zealand at 5:45pm AWST on Saturday October 4 at Optus Stadium, Perth

    Spring Tour

    Wallabies v Japan at TBC on Saturday October 25 at National Stadium, Tokyo

    Wallabies v England, at 2:10am AEDT on Sunday November 2 at Allianz Stadium, London

    Wallabies v Italy at 4:40am AEDT on Sunday November 9 at Bluenergy Stadium, Udine

    Wallabies v Ireland at 7:10am AEDT on Sunday November 16 at Aviva Stadium, Dublin

    Wallabies v France at 7:10am on Sunday November 23 at Stade de France, Paris


    Continue Reading

  • Lassana Diarra seeks rightful damages following CJEU victory – FIFPro

    1. Lassana Diarra seeks rightful damages following CJEU victory  FIFPro
    2. Former Chelsea midfielder seeks £56m in damages over contract dispute  FourFourTwo
    3. Soccer Diarra FIFA Transfer Rules  The Lufkin Daily News
    4. Diarra seeks damages in Belgian court after FIFA fight over transfer rules  MLex
    5. FIFA hit with $76M claim by Lassana Diarra in decade-long soccer transfer rules case  Newsday

    Continue Reading