- ‘Any ambiguity on terrorism narrative will not be tolerated’ RADIO PAKISTAN
- Talal Chaudhry tells PTI to ‘go to Afghanistan’ for having ‘so much sympathy’ Geo News
- Khyber Pakhtunkhwa chief minister’s statement on terrorism termed misleading Dunya…
Blog
-
'Any ambiguity on terrorism narrative will not be tolerated' – RADIO PAKISTAN
-
SpaceX lines up afternoon launch, readies for Crew-11 return – Orlando Sentinel
- SpaceX lines up afternoon launch, readies for Crew-11 return Orlando Sentinel
- SpaceX mission 2026: 29 Starlink satellites deployed in year’s third flight The News International
- 321 Launch: Space news you may have missed over the past week (Jan….
Continue Reading
-
Whole-genome sequencing improves PARP inhibitor treatment prediction
A whole-genome sequencing approach shows early promise over current commercial methods for identifying more patients likely to benefit from PARP inhibitor cancer treatments, according to a study led by Weill Cornell Medicine and…
Continue Reading
-
Response to ‘Towards an individualized strategy in perioperative chemotherapy for pancreatic cancer’
TFS: Conception of project, data analysis, interpretation of results, writing the manuscript; YHAW: Conception of project, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; AO: Conception of project, acquired data, interpretation of results, revised the manuscript, approved the final version; MA: Conception of project, data analysis, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; WM: Conception of project, revised the manuscript, approved the final version; MGB: Conception of project, revised the manuscript, approved the final version, supervision; RAB: Conception of project, revised the manuscript, approved the final version, supervision; JWW: Conception of project, revised the manuscript, approved the final version, supervision; MDC: Conception of project, revised the manuscript, approved the final version, supervision. All coauthors meet the following criteria: 1. Conceived and/or designed the work that led to the submission, acquired data, and/or played an important role in interpreting the results. 2. Drafted or revised the manuscript. 3. Approved the final version. 4. Agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Continue Reading
-
Dilated cardiomyopathy-associated RNA-binding motif protein 20 regulates long pre-mRNAs in neurons
The CLIP experiments were performed according to the seCLIP protocol (Van Nostrand et al., 2017a) with some minor modifications (Traunmüller et al., 2023). Olfactory bulbs from seven mice were pooled for each biological replicate, and for heart tissue, one heart was used per biological replicate. Samples were flash-frozen and ground on dry ice first in a metal grinder and a porcelain mortar. The frozen powder was transferred into a plastic Petri dish and distributed in a thin layer. The samples were UV-cross-linked three times at 400 mJ/cm2 on dry ice with a UV-cross-linker (Cleaver Scientific). The powder was mixed and redistributed on the Petri dish before each UV exposure. After cross-linking, the powder was collected in 3.5 ml (olfactory bulbs) or 5.5 ml (heart) in lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, complete protease inhibitors, Roche) and 4 U/ml Turbo-DNase (Thermo Fisher). Samples were further processed as described in detail below.
For the clip samples preparation, the lysate was transferred into a glass homogenizer and homogenized by 30 strokes on ice. 1 ml aliquots of homogenized tissue were transferred to 2 ml tubes, 10 µl of RNaseI (Thermo Fisher) diluted in PBS (1:5–1:40) were added to each tube. Samples were incubated at 37°C with shaking for 5 min at 1200× rpm and then put on ice. 10 µl RNasin RNase inhibitor (40 U/µl, Promega) was added to each tube. Samples were mixed and centrifuged at 16,000 × g for 15 min at 4°C. The supernatants were transferred to a new tube, and 60 µl from each sample was taken and further processed for sized-matched INPUT (SMIn). 10 µl HA-magnetic beads (Pierce) was added to each sample and incubated at 4°C for 4 hr in a rotating shaker. Following incubation, the beads were washed 2× with a high salt wash buffer (50 mM Tris-HCl pH 7.5, 1 M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate), 2× with the lysis buffer, 2× with low salt wash buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.2% Tween-20) and 1× with PNK buffer (70 mM Tris-HCl pH 6.5, 10 mM MgCl2). Beads were resuspended in 100 µl PNK mix (70 mM Tris-HCl pH 6.5, 10 mM MgCl2, 1 mM DTT, 100 U RNasin, 1 U TurboDNase, 25 U Polynucleotide-Kinase [NEB]) and incubated at 37°C for 20 min on a shaking termomixer (1200× rpm). Upon RNA dephosphorylation, the beads were washed (2× high salt, 2× lysis, and 2× low salt buffers as before) and additionally with 1× Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2). Beads were then resuspended in 50 µl ligase mix (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 3% DMSO, 15% PEG8000, 30 U RNasin, 75 U T4 RNA-ligase [NEB]). 10 µl of the beads/ligase mix was transferred to a new tube, and 1 µl of pCp-Biotin (Jena Bioscience) was added to validate IP of the RNA-protein complexes by western blot. 4 µl of the RNA-adaptor mix containing 40 µM of each InvRiL19 & InvRand3Tr3 (IDT) was added to the remaining of the samples (40 µl). Samples were incubated at room temperature for 2 hr for adaptor ligation. Samples were washed 2× with high salt, 2× with lysis, and 1× with low salt buffers. Finally, beads were resuspended in 1× LDS sample buffer (Thermo Fisher) supplemented with 10 µM DTT and incubated for 10 min at 65°C, shaking on a thermomixer at 1200× rpm. Eluates or inputs were loaded on 4–12% Bis-Tris, 1.5 mm gel (Thermo Fisher) and separated at 130 V for ~1.5 hr. Proteins were transferred overnight at 30 V to a nitrocellulose membrane (Amersham). The membranes were placed in a 15 cm Petri dish on ice, and an area between 55 and 145 kDa was cut out into small pieces and transferred into a 2 ml tube.
RNA extraction, reverse transcription using InvAR17 primer, cDNA clean-up using silane beads (Thermo Fisher), second adaptor ligation (InvRand3Tr3), and cDNA purification steps were performed as previously described (Van Nostrand et al., 2016). The sequencing libraries were amplified using Q5-DNA polymerase (NEB) and i50X/i70X Illumina indexing primers (IDT). Final libraries were amplified with 14 cycles. Libraries were purified and concentrated with ProNEX size-selective purification system (Promega) using sample/beads ratio of 1/2.4. Samples were loaded on a 2% agarose gel, and the area corresponding to the size between 175 and 350 bp was cut out. The amplified and purified libraries were then extracted from the gel using a gel extraction kit (Machery&Nagel) and eluted with 16 µl.
The concentrations and the size distributions of the libraries were determined on the Fragment Analyzer system (Agilent). 75 bp single-end sequencing was performed on the NextSeq500 platform using Mid Output Kit v2.5 (75 cycles).
Adaptor and primer sequences used in this study:
Name Sequence InvRi L19 /5Phos/rArGrArUrCrGrGrArArGrArGrCrArCrA rCrGrUrC/3SpC3/ InvRand3Tr3 /5Phos/NNNNNNNNNNAGATCGGAAGA GCGTCGTGT/3SpC3/ InvA R17 CAGACGTGTGCTCTTCCGA i501 AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i502 AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATC*T i503 AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i504 AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGATC*T i701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i702 CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i703 CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i704 CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T X* = Phosphorthioated base
seCLIP data processing was performed as described (Van Nostrand et al., 2016; Van Nostrand et al., 2017b; Van Nostrand et al., 2020). In brief, raw reads were processed to obtain unique CLIP tags mapped to mm10 using Clipper (https://github.com/YeoLab/clipper ; Lovci et al., 2025; https://github.com/YeoLab/eclip ; Yee and Domissy, 2022). Reads from replicates 1 and 2 from the olfactory bulb were concatenated. Peak normalization was performed by processing the SMInput samples using the same peak calling pipeline. Irreproducible discovery rate (IDR) analysis was performed to identify reproducible peaks across biological replicates (Li et al., 2011). IDR (https://github.com/nboley/idr; Boley, 2017) was used to rank seCLIP peaks by the fold change over the size-matched input. Clip peaks were called based on IDR<0.05. We observed some short highly represented sequences that were not specific to RBM20 seCLIP isolations, which were excluded based on peak shape and width (<30 bp) using StoatyDive (Heyl and Backofen, 2021).
For motif discovery, cross-link-induced truncation sites (CITS) were called using the CTK pipeline (Shah et al., 2017). Briefly, unique tags from replicates were combined, and CITS were called by requiring FDR<0.001. Sequences from –10 bp to +10 bp from called CITS were used as input sequences for DREME software (Bailey et al., 2009; Bailey et al., 2015; Nystrom and McKay, 2021). As a control, sequences of the same length located 500 bp upstream of the CITS site (–510 to –490 bases) were used. Enrichment of the UCUU motif at the CITS sites was calculated.
Continue Reading
-
LSU 70-65 Texas (Jan 11, 2026) Game Recap – ESPN
- LSU 70-65 Texas (Jan 11, 2026) Game Recap ESPN
- NO.lsutexas.011226_2433 MJ.JPG The Advocate
- Here is the latest SEC sports news from The Associated Press Daily Jefferson County Union
- LSU coach Kim Mulkey taps into Louisiana cooking culture to…
Continue Reading
-
Gut Bacteria Protect Mice With Influenza A From Bacterial Pneumonia, Study Finds – Georgia State University News – Institute for Biomedical Sciences, Press Releases, Research, University Research
Gut Bacteria Protect Mice With Influenza A From Bacterial Pneumonia, Study Finds – Georgia State University News – Institute for Biomedical Sciences, Press Releases, Research, University Research – Health & Wellness
Continue Reading
-
Google scraps AI Overviews for certain medical queries: Find out why
Google scraps AI Overviews for certain medical queries: Find out why Following an investigation by a prominent news outlet that found misleading information in Google’s AI Overviews for health-related searches, the search giant has removed the AI-assisted summaries for health-specific queries.
The investigation found that asking “what is the normal range for liver blood tests” yielded results that failed to consider crucial factors such as age, sex, ethnicity, and nationality. It is suspected that this omission might lead users to misinterpret their health results.
The Guardian reported that AI Overviews have been eliminated for queries like “what is the normal range for liver blood tests” and “what is the normal range for liver function tests.” However, variations of the same queries, such as “lft reference range,” are still offering AI summaries.
As reported by TechCrunch, there were no AI Overviews upon testing these queries shortly after the Guardian’s report, although Google still provided an option to ask in AI Mode.
The interesting twist is: the top result often directed users to the Guardian’s article discussing the removal.
The company does not comment on specific removals but is committed to making meaningful improvements, a Google spokesperson was quoted as saying.
They noted that Google’s internal health experts reviewed the queries in question and found that the information was not necessarily inaccurate and was supported by reputable sources.
Vanessa Hebditch, the director of communications and policy at the British Liver Trust, cherished the removal but expressed concern that this action addresses only a single issue rather than AI Overviews’ wider implications in health-related searches.
Continue Reading
-
A pill that confirms you actually swallowed your medicine
By using a temporary Faraday-cage coating that dissolves in minutes, the SAFARI capsule delivers highly specific proof of pill ingestion, without batteries, retrieval, or long-term electronic waste.
Study: Bioresorbable RFID capsule…
Continue Reading
-
UGREEN launches AI NAS, security, and 300W GaN charger at CES 2026 – Engineering.com
- UGREEN launches AI NAS, security, and 300W GaN charger at CES 2026 Engineering.com
- Why UGREEN’s new iDX NAS is more than storage—and superior to the Cloud Macworld
- Ugreen is expanding into AI-powered smart home surveillance The Verge
- Ugreen…
Continue Reading