United Launch Alliance is set to perform its first national security mission with its newly developed Vulcan rocket, a key test of the vehicle’s ability to put satellites into high orbits above the Earth.
The mission is for the US Space Force and will take off from Cape Canaveral, Florida, during a one-hour launch window that begins at 7:59 p.m. local time on Tuesday.
Six planets — Mercury, Venus, Jupiter, Saturn, Uranus and Neptune — will appear in a dark night sky together for almost a week, beginning Sunday, Aug. 17. The fairly rare “planetary parade,” which is sometimes mistakenly called a planetary alignment, will continue through Wednesday, Aug. 20.
The celestial gathering, last seen in February, will appear in the eastern sky about an hour before sunrise. Although most of these planets have been visible in the morning sky for weeks, Mercury will join the fray, bringing the planet count from five to six.
Under clear skies, you should be able to spot Venus, Jupiter and Saturn. Mercury will be closer to the horizon but still bright enough to be seen by most observers. However, Uranus (appearing between Jupiter and Saturn in the sky) and Neptune (close to Saturn in the sky) are too dim and distant to be seen with the naked eye. The only way to see these two ice giants is by using a good telescope.
Although it’s relatively rare for six planets to appear in the sky simultaneously, the beauty of the view will be vastly increased by the waning crescent moon.
Related: How to photograph the moon: Tips on camera gear, settings and composition
On Aug. 17 and Aug. 18, a crescent moon will rise above Jupiter and Venus. The two brightest planets in the night sky are now slowly moving apart after an incredibly close conjunction on Aug. 12.
Mercury may be visible below Jupiter and Venus, but it will be easier to see it on Aug. 19. On that morning, and on Aug. 20, a slim crescent moon will be very close to Jupiter and Venus — a visual highlight of the “planetary parade.”
By around Aug. 21, Mercury will begin to fall back into the sun’s glare and will become more difficult to see.
According to the Star Walk app, there will be two six-planet parades in 2026: one after sunset in February and another before sunrise in August.
The iPhone catapulted Apple onto the Mount Rushmore of tech, and the device’s successor could do the same for someone else.
Smartphones as we know them will eventually feel “primitive,” billionaire venture capitalist Marc Andreessen said in a new interview on the “TBPN” technology podcast that aired Friday. At some point, he said, everything becomes obsolete.
The big question: What comes after the smartphone?
“Whoever cracks the code on that will be the next Apple,” Andreessen, cofounder of venture capital firm Andreessen Horowitz, said.
Creating a product that makes the smartphone obsolete will require a level of innovation that the world has yet to see, Andreessen said. It could take three years or two decades.
However, companies are already working to develop gadgets that don’t require a screen.
OpenAI cofounder Sam Altman, for one, is developing an AI-powered device that isn’t a smartphone or wearable. Altman has teamed up with the former Apple design chief Jony Ive, one of the key figures behind the iPhone, though they’ve kept much of the details under wraps, including its form factor.
Elsewhere, AI startups like Rabbit and Humane are experimenting with screenless devices that operate as a companion to your smartphone or use projections instead of a screen.
Meanwhile, Meta’s smart glasses, fitted with cameras, a voice assistant, and speakers, are showing signs of consumer interest. However, CEO Mark Zuckerberg doesn’t expect them to replace phones anytime soon.
“It’s not like we’re going to throw away our phones,” Zuckerberg told The Verge in September, “but I think what’s going to happen is that, slowly, we’re just going to start doing more things with our glasses and leaving our phones in our pockets more.”
Andreessen said the object that kicks off a new era of technology could be eye-based, voice-operated, or have some sort of environmental computing. (His VC firm Andreessen Horowitz did not immediately respond to a request for comment from Business Insider.)
Apple itself could be the one to lead the next revolution in tech. It likely has time to work on it, Andreessen said.
“I think it’s highly likely that we’ll have a phone for a very long time,” he said.
Published on
ADVERTISEMENT
Prince Harry and Meghan Markle have renewed their partnership with Netflix in a fresh multi-year deal, continuing their collaboration through Archewell Productions.
The couple say the agreement reflects their mission to create “thoughtful content across genres that resonates globally.”
The Duke and Duchess of Sussex confirmed the extension on Monday (11 August), with Netflix gaining first-look rights on upcoming projects. The renewed deal includes the return of “With Love, Meghan”, a lifestyle and cooking series starring the Duchess of Sussex, as well as a new documentary short Masaka Kids, A Rhythm Within, which centres on an orphanage in Uganda.
“My husband and I feel inspired by our partners who work closely with us and our Archewell Productions team to create thoughtful content across genres that resonates globally, and celebrates our shared vision,” Meghan said in a statement.
Also on the slate is Meet Me at the Lake, a feature adaptation of Carley Fortune’s romantic novel about a decade-spanning love story sparked by a chance encounter.
This latest agreement is a continuation of Harry and Meghan’s post-royal streaming ventures, which began with a widely publicised Netflix partnership in 2020 – reported at the time to be worth around $100 million (€86.2 million).
Previous Archewell-produced projects for the streaming platform include the docuseries Harry & Meghan, Heart of Invictus, Live to Lead, and Polo.
Bela Bajaria, Netflix’s chief content officer, praised the couple’s storytelling efforts: “Harry and Meghan are influential voices whose stories resonate with audiences everywhere. The response to their work speaks for itself.”
But not all of that response has been glowing.
While Harry & Meghan performed strongly with 23.4 million viewers following its 2022 debut, “With Love, Meghan” has had a rockier journey. Despite being billed by Netflix as its most-watched culinary show this year, it pulled in just 5.3 million views – placing it outside the platform’s top 300 most-viewed shows in the first half of 2025.
Critics did not hold back. Reviews of the first series called the show “out of touch”, and its polished, curated aesthetic drew ridicule across social media platforms.
Memes and TikToks poked fun at the former actress’s on-screen persona, with some viewers calling the series overly staged.
Still, Netflix is backing a second season – set to air later this month – as well as a holiday special in December, inviting audiences to “join Meghan in Montecito for a magical holiday celebration.” The series is also linked to her lifestyle brand, As Ever, which includes products like rosé wine and jams.
Human lung adenocarcinoma A549 cells (American Type Culture Collection (ATCC) CCL-185, gift from the lab of P. Hofman, IRCAN, Nice, France), human breast adenocarcinoma MDA-MB-231 cells (gift from the lab of D. Picard, University of Geneva, Switzerland), human bronchial epithelial BEAS-2B cells (ATCC CRL-9609, gift from the lab of P. Hofman), human tumorigenic lung BZR cells obtained by transfer of the v-Ha-ras oncogene into BEAS-2B cells (ATCC CRL-9483, gift from the lab of P. Hofman), human lung epidermoid carcinoma Calu1 cells, human melanoma A375 cells (ATCC CRL-1619, gift from the lab of P. Hofman), human cervix cancer HeLa cells, human colon cancer HCT116 and DLD1 cells, lung adenocarcinoma LuCa62 cells derived from a patient (gift from V. Serre-Beinier, CMU, Geneva, Switzerland), human embryonic kidney HEK 293 cells and human retinal pigment epithelial RPE-1 cells were grown in DMEM high-glucose media supplemented with 10% FBS, 2 mM l-glutamine, 100 U ml−1 penicillin and 100 µg ml−1 streptomycin at 37 °C and 5% CO2. Mesothelioma JL1, ZL34 and H2052/484 cell lines (gift from V. Serre-Beinier) were grown in RPMI 1640 with GlutaMAX media (Life Technologies, 61870-010) supplemented with 10% FBS, 100 U ml−1 penicillin and 100 µg ml−1 streptomycin (Corning, 30-002-CI) in an incubator at 37 °C and 5% CO2. A549 Bax/Bak double knockout cells were a generous gift from A. Sfeir (Sloan Kettering Institute).
For the IC50 determination of d-Cys or d-cystine, and for most proliferation analyses, cells were seeded in six-well plates at a density of 5 × 103 cells per cm2, unless specifically mentioned, and incubated overnight at 37 °C. Cells were then treated with d-Cys (Carl ROTH, 7874.1) or d-cystine (Sigma-Aldrich, 285463) at the indicated concentrations. When not specified, d-Cys was used at 500 µM. For cell counting assays, cells were harvested by trypsination at the indicated times and counted in 0.4% trypan blue solution using a Neubauer counting chamber. For metabolic and proteomic analyses, cells were lysed 72 h after the treatments. For biochemical analyses, A549 and BEAS-2B cells were seeded into tissue culture flasks at densities between 32 × 103 and 4 × 103 cells per cm2, grown overnight, supplemented with 500 µM d-Cys for the following 2 days, subjected to a medium exchange including d-Cys replenishment, and harvested the next day. For erastin treatment, 24 h after seeding the cells were treated with 1 µM compound (Sigma-Aldrich, E7781) in the presence or absence of 500 µM d-Cys. Seventy-two hours later, cells were harvested and counted as described above.
Transient Cys-free cultivation of A549 cells was performed in Cys-free/Met-free DMEM (Thermo Fisher, 21013-024), with addition of 200 µM methionine and standard supplements. When indicated, cells were grown in the presence of 375 µM TCEP. Tissue culture media including l-Cys, d-Cys or erastin supplements were freshly prepared and exchanged daily. The autoxidation of d-Cys and TCEP under normoxic tissue culture atmosphere was monitored in 50 mM Tris/HCl buffer (pH 7.4) by Ellman’s reagent DTNB (5,5′-dithiobis-(2-nitrobenzoic acid).
For hypoxia experiments, the culture medium was pre-equilibrated for 4 days in a sealed hypoxic chamber maintained at 1% O2 and 5% CO2 before initiating the experiment. A549 cells (1.5 × 105 cells per well) were seeded overnight in six-well plates, after which the medium was replaced with pre-equilibrated hypoxic growth medium. The cells were cultured with or without 500 μM d-Cys. The plates were then placed in a sealed, humidified hypoxic chamber containing 1% O2 and 5% CO2 and incubated at 37 °C for 72 h before performing cell counting or crystal violet staining.
A total of 1,000 cells per dish were seeded in 6-cm dishes and incubated overnight at 37 °C. Twenty-four hours later, cells were treated with 100 µM d-Cys for 2 weeks. Cells were then washed with PBS, fixed in 4% paraformaldehyde (PFA) solution and stained with 0.5% crystal violet solution (Sigma-Aldrich, C0775) in 30% ethanol for 20 min. The stained cells were then washed with H2O and left to dry overnight.
A total of 1,000 cells per well were seeded in culture media containing 100 µM to 500 µM d-Cys in 96-well plates coated with 1.5% agarose. Spheroid volume was quantified by light microscopy twice per week for 17 days.
A549 cells were transduced with lentivirus containing lentiCas9-Blast plasmid (gift from F. Zhang, Addgene plasmid no. 52962). After 24 h, cells were selected with 5 µg ml−1 blasticidin for 7 days. After selection, cells were seeded at one cell per well in 96-well plates for cell cloning. Following single-cell colony formation, clones were screened for Flag expression and one Flag-positive clone was selected. Then, Cas9-expressing cells were infected with lentivirus containing a single guide RNA (sgRNA) of interest in lentiGuide-Puro vector (Addgene, plasmid no. 52963). For each gene of interest, two sgRNAs were used. The sgRNA target sequences used were as follows:
SLC3A2 (CD98)-1: GACCTTACTCCCAACTACCG;
SLC3A2 (CD98)-2: TGAGTGGCAAAATATCACCA;
SLC7A11 (xCT)-1: AAGGGCGTGCTCCAGAACAC;
SLC7A11 (xCT)-2: GAAGAGATTCAAGTATTACG;
NFE2L2-1: CACATCCAGTCAGAAACCAG;
NFE2L2-2: CATACCGTCTAAATCAACAG;
NCOA4-1: AGATTGGCTAGTGACTCCCC;
NCOA4-2: GAGGTGTAGTGATGCACGGA.
After 24 h, cells were selected with 5 µg ml−1 puromycin for 7 days and expression of the gene of interest was verified by western blotting.
Cas9-expressing A549 cells were infected with the human CRISPR Brunello lentiviral pooled library (Addgene, 73178-LV) at a multiplicity of infection of 0.3 such that every gRNA is represented in 500 cells. After 48 h, infected cells were selected with puromycin for at least 6 days. After selection, 40,000,000 cells were seeded per condition to maintain the expression of the whole library. The following day, cells were treated with H2O (control condition) or with 500 µM of l-Cys or d-Cys. Cells in control and d-Cys conditions were passaged every 3 days and maintained at a minimum of 40,000,000 cells. Cells in the d-Cys condition were refreshed with media containing 500 µM of d-Cys every 3 days until the emergence of resistant clones. At least 40,000,000 cells were collected for genomic DNA extraction at day 0 after selection and at the end of the treatment (day 11 for control and l-Cys conditions, and day 24 for d-Cys condition). Genomic DNA was extracted from cell pellets. gRNA inserts were amplified via PCR using primers harbouring Illumina TruSeq adapters with i5 and i7 barcodes, and the resulting libraries were sequenced by next-generation sequencing on an Illumina HiSeq 4000.
To generate the SLC3A2 plasmid the sequence AgeI-SLC3A2-XhoI-3xGly linker-FLAG-STOP-EcoRI was inserted between the AgeI and EcoRI sites of TRIPz replacing the TurboRFP. To make the SLC7A11 plasmid the sequence AgeI-SLC7A11-SalI was inserted between the AgeI and XhoI sites of the SLC3A2 construct giving AgeI-SLC7A11-SalI/XhoI-3xGly linker-FLAG-STOP-EcoRI. The final sequence of both plasmids was verified.
BEAS-2B cells were infected with lentivirus containing pTRIPz-EGP (gift from the lab of D. Picard), pTRIPz-SLC3A2-Flag or pTRIPz-SLC7A11-Flag. After 24 h, cells were selected with 5 µg ml−1 puromycin for 7 days. After selection, cells were seeded for d-Cys treatment at 100 µM in combination with 100 ng ml−1 doxycycline. After 72 h, cells were harvested and counted.
Open reading frames of C-terminally FLAG-tagged SLC3A2 and SLCA11 were subcloned into pEGFP-derived mammalian expression vectors (TaKaRa) by substitution of the EGFP open reading frame using standard cloning techniques. Transfection of HeLa cells by electroporation22 was performed in 265 µl of buffer using 6 µg of each CD98-encoding and xCT-encoding plasmid or 12 µg of a reference vector encoding a PEST-sequence destabilized EGFP. After overnight tissue culture, cells were supplemented with 500 µM d-Cys. Two days later, medium including d-Cys was replaced and cells were harvested the following day. Cells were thus exposed to d-Cys for a total of 3 days.
A549 cells were transduced with lentivirus containing pBOB-EF1-FastFUCCI-Puro plasmid (gift from the lab of D. Picard, Addgene plasmid no. 86849). After 24 h, cells were selected with 5 µg ml−1 puromycin for 7 days. Surviving cells were seeded on coverslips in six-well plates, for d-Cys treatment as described above, then fixed for 20 min at room temperature in 4% PFA solution. The coverslips were washed and mounted on slides for imaging. The proportion of cells in G1 phase (mKO-hCdt1, red probe) and in S/G2, G2 or M phases (mAG-hGeminin, green probe) was quantified.
Cells were seeded in six-well plates containing coverslips and treated with increasing concentrations of d-Cys as described above. After 72 h, cells were incubated with 10 μM BrdU for 8 h in cell culture medium at 37 °C. Then, cells were washed, fixed for 20 min at room temperature in 4% PFA solution and permeabilized in PBS containing 0.15% Triton X-100 for 10 min at room temperature, before addition of 2 M HCl to denature DNA. Cells were then incubated in PBS containing 0.15% Triton X-100 and 5% normal goat serum for 30 min at room temperature and incubated in a solution containing anti-BrdU antibody (Sigma-Aldrich, 11170376001) diluted at 1:200 and 5% normal goat serum at 4 °C overnight. The last step of immunostaining was performed according to standard immunocytochemistry protocols.
Cells were seeded in six-well plates containing coverslips and treated with d-Cys as described above. After 72 h, cells were washed, fixed for 20 min at room temperature in 4% PFA solution and permeabilized in PBS containing 0.15% Triton X-100 for 10 min at room temperature. Cells were incubated in PBS containing 0.15% Triton X-100 and 1% BSA for 30 min at room temperature and incubated in anti-53BP1 and anti-γ-H2AX antibodies diluted at 1:50 and 1:200, respectively, in a solution containing 1% BSA, at 4 °C overnight. The last step of immunostaining was performed according to standard immunocytochemistry protocols.
For immunofluorescence, cells were cultured on glass coverslips in 24-well plates for 2 days seeded at a low density of 12,500 cells per well and at a high density of 2 × 105 cells per well. Cells were washed two times with cold PBS, fixed in 1% PFA for 12 min, followed by rinsing with and incubating with methanol (MeOH) at −20 °C for 5 min, and 2× washes in PBS. Cells were permeabilized with 0.2% of Triton X-100 in PBS (5 min at room temperature) and saturated for 20 min with 2% of BSA in PBS. Incubation with primary antibodies (xCT; 1:200 dilution) was carried out for 2 h at room temperature, followed by washing 3× with PBS; incubation with anti-rabbit secondary antibody (Supplementary Table 7) and rhodamine-phalloidin (Thermo Fisher Scientific, R415; 1:400 dilution) was carried out for 1 h at room temperature, followed by 3× washes with PBS. Coverslips were mounted with Fluoromount-G. Slides were imaged on a Zeiss LSM 800 confocal microscope using a Plan-Apochromat ×63/1.40 oil objective (1,024 × 1,024 pixels). Maximum intensity projections of z-stack images (typically 3–6 confocal planes over 1.0–1.5 µm, step size = 0.3 µm) were obtained. z-sections were collected in 0.27-μm steps over 6 µm. Images were extracted from .czi files using ImageJ, adjusted and cropped using Adobe Photoshop, and assembled in Microsoft PowerPoint.
Cells grown on Permanox slides were washed in 100 mM phosphate buffer (KH2PO4/Na2HPO4; pH 7.4) and fixed for 20 min at room temperature in sodium cacodylate buffer supplemented with 2.5% glutaraldehyde. Cells were post-fixed for 20 min at room temperature in 2% osmium tetroxide, and pre-stained in 2% of uranyl acetate for 10 min at room temperature. After several washes in phosphate buffer, cells were dehydrated sequentially in 50%, 70%, 90% and 100% ethanol (for 10 min for each procedure). The samples were then infiltrated sequentially in 1:1 (vol/vol) ethanol:Epon resin (EMS), 1:3 ethanol:Epon resin for 30 min for each procedure, 100% Epon resin for 3 h, and finally covered with BEEM embedding capsules (EMS) filled with 100% Epon resin. Polymerization was initiated by raising the temperature to 60 °C and keeping them at this temperature during 48 h. Ultrathin sections were isolated on copper grids and stained for 10 min in 2% uranyl acetate and for 5 min in Reynold’s lead citrate, and examined at 120 kV using a Tecnai G2 transmission electron microscope.
Protein content was quantified using the Pierce BCA protein assay kit (Thermo Fisher Scientific, 23227). Proteins of cell lysates were separated by SDS–PAGE or tricine–PAGE and immunoblotted according to standard techniques. Antibodies used are listed in Supplementary Table 7.
A total of 50,000 cells per well were seeded in six-well plates and treated with d-Cys. After 72 h, cells were stained with 5 µM mitoSOX (Molecular probes, M36008) diluted in Dulbecco′s phosphate buffered saline with MgCl2 and CaCl2 (DPBS Mg/Ca, Sigma-Aldrich, D8662) for 15 min at 37 °C. Cells were then harvested and resuspended in 300 µl PBS for flow cytometry analysis. A Gallios flow cytometer (Beckman Coulter) was used for the analysis.
In total, 50,000 cells per well were seeded in six-well plates and treated with d-Cys. After 72 h, cells were harvested and resuspended in 1 ml DPBS Mg2+/Ca2+ containing 5 µM BODIPY 581/591 C11 (Invitrogen, D3861) for 20 min at 37 °C. Then, cells were washed and resuspended in 300 µl PBS for flow cytometry analysis. A Gallios flow cytometer (Beckman Coulter) was used for the analysis.
A total of 40,000 cells per well previously cultured in the absence or presence of 500 µM d-Cys for 48 h were seeded in Agilent Seahorse XF24 cell culture microplates (Bucher Biotec AG, 100777-004) and cultured for an additional 15 h in the presence or absence of d-Cys. Then cells were incubated for 1 h in DMEM media (Sigma-Aldrich, D5030) supplemented with 25 mM D-glucose, 2 mM glutamine (PAN BIOTECH, P04-80100) and 25 mM Hepes (Thermo Fischer Scientific, 15630080) at pH 7.4 without CO2 before plate reading. Oxygen consumption rate was measured under basal conditions or following the addition of oligomycin (2 μM), the uncoupler FCCP (1 μM) and the electron transport inhibitors rotenone (1 μM) and antimycin A (1 μM) using a Seahorse XFe24 analyser.
Separation of cellular constituents into a crude mitochondria-containing organellar and a cytosolic fraction by digitonin-based plasma membrane permeabilization was performed as described20. Enzyme activities were analysed in multiwell plates based on established assays27,58.
Cells were extracted by the addition of MeOH:H2O (4:1; 1 ml). This solution containing scraped lysed cells was further homogenized in the Cryolys Precellys 24-sample homogenizer (2 × 20 s at 10,000 rpm, Bertin Technologies) with ceramic beads. Homogenized extracts were centrifuged for 15 min at 4,000g at 4 °C, and the resulting supernatant was collected and evaporated to dryness in a vacuum concentrator (LabConco). Dried sample extracts were resuspended in MeOH:H2O (4:1, vol/vol) before liquid chromatography–tandem mass spectrometry (LC–MS/MS) analysis according to the total protein content.
Cell lysates were analysed by hydrophilic interaction liquid chromatography coupled to tandem mass spectrometry (HILIC-MS/MS) in both positive and negative ionization modes using a 6495 triple-quadrupole system (QqQ) interfaced with a 1290 ultra-high-performance liquid chromatography (UHPLC) system (Agilent Technologies) In positive mode, the chromatographic separation was carried out in an Acquity BEH Amide, 1.7 μm, 100 mm × 2.1 mm internal diameter (i.d.) column (Waters). The mobile phase was composed of A = 20 mM ammonium formate and 0.1% formic acid in water and B = 0.1% formic acid in acetonitrile (ACN). The linear gradient elution from 95% B (0–1.5 min) down to 45% B (1.5–17 min) was applied, and these conditions were held for 2 min, followed by 5 min of column re-equilibration at the initial gradient conditions. The flow rate was 400 μl min−1, the column temperature was 25 °C, and the sample injection volume was 2 µl. In negative mode, a SeQuant ZIC-pHILIC (100 mm, 2.1 mm i.d. and 5-μm particle size, Merck) column was used. The mobile phase was composed of A = 20 mM ammonium acetate and 20 mM NH4OH in water at pH 9.7 and B = 100% ACN. The linear gradient elution from 90% B (0–1.5 min) to 50% B (8–11 min) down to 45% B (12–15 min) was applied, followed by a 9-min post-run routine for column re-equilibration. The flow rate was 300 μl min−1, the column temperature was 30 °C, and the sample injection volume was 2 µl. For both analyses, the ESI source conditions were set as follows: dry gas temperature, 290 °C; nebulizer 35 psi, flow rate 14 l min−1; sheath gas temperature 350 °C, flow 12 l min−1; nozzle voltage, 0 V; capillary voltage, ±2,000 V. Data were acquired in dynamic multiple reaction monitoring (DMRM) mode with a total cycle time of 600 ms. Pooled quality-control (QC) samples (representative of the entire sample set) were analysed periodically throughout the overall analytical run, to assess the quality of the data, correct the signal intensity drift and remove the peaks with poor reproducibility (coefficient of variation > 30%). In addition, a series of diluted QC samples were prepared by dilution with MeOH: 100% QC, 50% QC, 25% QC, 12.5% QC and 6.25% QC and analysed at the beginning and at the end of the sample batch. This QC dilution series served as a linearity filter to remove the features that do not respond linearly or where correlation with the dilution factor is <0.
Raw LC–MS/MS data were processed using the Agilent Quantitative analysis software (version B.07.00, MassHunter Agilent technologies). Relative quantification of metabolites was based on Extracted Ion Chromatogram areas for the monitored MRM transitions. Data quality assessment was done in R (http://cran.r-project.org/). Signal intensity drift correction was done within the LOWESS/Spline algorithm followed by filtering of ‘not-well behaving’ peaks (coefficient of variation (QC peaks) > 30% and R2 (QC dilution curve < 0.75). A t-test (on log10-transformed data) was used to test the significance of metabolite changes in different conditions with an arbitrary level of significance, P value = 0.05 (and adjusted P value corrected for multiple testing with the Benjamini–Hochberg method).
Cell culture was extracted by the addition of 1 ml of an extraction solution of MeOH:water:borate buffer 50 mM:iodoacetamide 1 M (80/9.6/8.8/1.6). This solution containing scraped lysed cells was further homogenized in the Cryolys Precellys 24-sample homogenizer (2 × 20 s at 10,000 rpm, Bertin Technologies) with ceramic beads. Homogenized extracts were centrifuged for 15 min at 4,000g at 4 °C, and the resulting supernatant was collected and evaporated to dryness in a vacuum concentrator (LabConco). Dried sample extracts were resuspended in water before LC–MS/MS analysis.
Cell lysates were analysed by LC–MS/MS in both positive ionization mode using a 6495 triple-quadrupole system (QqQ) interfaced with a 1290 UHPLC system (Agilent Technologies). Chromatographic separation was carried out in an Acquity UPLC HSS T3 (2.1 mm × 100 mm × 1.8 µm) column (Waters). The mobile phase was composed of A = 0.1% formic acid in water and B = 0.1% formic acid in ACN. An isocratic step of 2.5 min at 100% A was applied, followed by a gradient elution down to 35% A and these conditions were held for 1.6 min, followed by 4 min of column re-equilibration at the initial gradient conditions. The flow rate was 400 μl min−1, the column temperature was 25 °C, and the sample injection volume was 2 µl. ESI source conditions were set as follows: dry gas temperature, 290 °C; nebulizer 35 psi, flow 14 l min−1; sheath gas temperature 350 °C, flow 12 l min−1; nozzle voltage, 0 V; capillary voltage, 4000 V. DMRM was used as acquisition mode with a total cycle time of 600 ms. Optimized collision energies for each metabolite were applied.
Raw LC–MS/MS data acquired in DMRM mode was processed using the Agilent Quantitative analysis software (version B.07.00, MassHunter Agilent technologies). Quantification of thiols was based on Extracted Ion Chromatogram areas for the monitored SRM transitions. For absolute quantification, calibration curves and the stable isotope-labelled internal standards were used to determine the response factor. Linearity of the standard curves was evaluated for each metabolite using 12 calibration points; in addition, peak area integration was manually curated and corrected when necessary.
The protein pellets were evaporated and lysed in 20 mM Tris-HCl (pH 7.5), 4 M guanidine hydrochloride, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM Na3VO4 and 1 µg ml−1 leupeptin using the Cryolys Precellys 24-sample homogenizer (2 × 20 s at 10,000 rpm, Bertin Technologies) with ceramic beads. BCA Protein Assay Kit (Thermo Scientific) was used to measure (A562 nm) total protein concentration (Hidex).
Biological samples were processed following the protocol described by Ferré et al.18. Briefly, dl-Cys (3,3-d2, 98%) was used as internal standard, and samples were sequentially submitted to protein precipitation, Cys reduction and derivatization. The resulting extracts were analysed using UHPLC coupled to triple-quadrupole MS. Details on sample preparation and analysis are provided in ref. 18. The cysteine levels obtained through this procedure were derived from initial reduction of plasma cystine into cysteine. As we can consider that most cysteine in the plasma is oxidized into cystine, to get the plasma cystine levels, we divided the cysteine values obtained by UHPLC/MS by two. These values are reported in Extended Data Fig. 10a.
Biological samples were processed as described in ref. 18. In addition, in one experiment, d-Cys was measured using the d-Cys luciferase assay6.
Samples were digested with trypsin using the Filter-Aided Sample preparation59 protocol with minor modifications. Proteins were resuspended in 200 µl of 8 M urea and 100 mM Tris-HCl and deposited on top of Microcon-30K devices. Samples were centrifuged at 9,391g at 20 °C for 30 min. All subsequent centrifugation steps were performed using the same conditions. An additional 200 µl of 8 M urea and 100 mM Tris-HCl was added, and devices were centrifuged again. Reduction was performed by adding 100 µl of 10 mM TCEP in 8 M urea and 100 mM Tris-HCl on top of filters followed by a 60-min incubation at 37 °C, protected from light and with gentle shaking. Reduction solution was removed by centrifugation, and filters were washed with 200 µl of 8 M urea and 100 mM Tris-HCl. After removal of washing solution by centrifugation, alkylation was performed by adding 100 µl of 40 mM chloroacetamide in 8 M urea 100 mM Tris-HCl and incubating the filters at 37 °C for 45 min with gentle shaking and protection from light. The alkylation solution was removed by centrifugation and another washing/centrifugation step with 200 µl of 8 M urea and 100 mM Tris-HCl was performed. This last urea buffer washing step was repeated twice followed by three additional washing steps with 100 µl of 5 mM Tris-HCl. Proteolytic digestion was performed overnight at 37 °C by adding on top of filters 100 µl of Endoproteinase Lys-C and Trypsin Gold in an enzyme/protein ratio of 1:50 (wt/wt). Resulting peptides were recovered by centrifugation. The devices were then rinsed with 50 µl of 4% trifluoroacetic acid and centrifuged. This step was repeated three times, and peptides were finally desalted on C18 StageTips60.
For TMT labelling, dried peptides were first reconstituted in 10 μl 100 mM HEPES pH 8 and 4 μl of TMT solution (25 µg μl−1 in pure ACN) was then added. TMT labelling was performed at room temperature for 1.5 h, and reactions were quenched with hydroxylamine to a final concentration of 0.4% (vol/vol) for 15 min. TMT-labelled samples were then pooled at a 1:1 ratio across all samples. A single-shot control LC–MS run was performed to ensure similar peptide mixing across each TMT channel to avoid the need for further excessive normalization. The combined samples were then desalted using a 100 mg SEP-PAK C18 cartridge (Waters) and vacuum centrifuged. Pooled samples were fractionated into 12 fractions using an Agilent OFF-Gel 3100 system following the manufacturer’s instructions. Resulting fractions were dried by vacuum centrifugation and again desalted on C18 StageTips.
For LC–MS/MS analysis, resuspended peptides were separated by reversed-phase chromatography on a Dionex Ultimate 3000 RSLC nano UPLC system connected in-line with an Orbitrap Q-exactive HF (Thermo Fisher Scientific). A capillary precolumn (Acclaim Pepmap C18, 3 μm 100 Å, 2 cm × 75-μm i.d.) was used for sample trapping and cleaning. A capillary column (75-μm i.d.; in-house packed using ReproSil-Pur C18-AQ 1.9-μm silica beads; Dr. Maisch; length, 50 cm) was then used for analytical separations at 250 nl min−1 over a gradient. Acquisitions were performed through Top 15 Data-Dependent acquisition. The first mass spectrometry scans were acquired at a resolution of 120,000 (at 200 m/z) and the most intense parent ions were selected and fragmented by high energy collision dissociation with a normalized collision energy of 32% using an isolation window of 0.7 m/z. Fragmented ion scans were acquired at a resolution of 30,000 (at 200 m/z) using a fixed maximum injection time of 100 ms, and selected ions were then excluded for the following 40 s.
Protein identification and isobaric quantification were performed using MaxQuant (1.6.10.43)61. The Human Uniprot reference proteome database (last modified on 5 Jul 2019; 74,468 sequences) was used for this search. Carbamidomethylation was set as a fixed modification, whereas oxidation (M), phosphorylation (S, T, Y) and acetylation (protein N-term) were considered as variable modifications. A maximum of two missed cleavages were allowed for this search. A minimum of two peptides were allowed for protein identification, and the FDR cut-off was set to 0.01 for both peptides and proteins.
Resulting text files were processed through in-house written R scripts (version 3.6.3; https://www.R-project.org/). A first normalization step was applied according to the sample loading normalization62. Assuming that the total protein abundances were equal across the TMT channels, the reporter ion intensities of all spectra were summed, and each channel was scaled according to this sum, so that the sum of reporter ion signals per channel equals the average of the signals across samples. A trimmed M-mean normalization step was also applied using the package EdgeR63 (version 3.26.8). Assuming that samples contain a majority of non-differentially expressed proteins, this second step calculates normalization factors according to these presumed unchanged protein abundances. Proteins with high or low abundances and proteins with larger or smaller fold-change values are not considered.
For purification of the proteins used for biochemical assays, E. coli cells expressing the appropriate proteins37,39 were thawed at room temperature, resuspended in 35 mM Tris-HCl pH 8 containing 300 mM NaCl, 5% (wt/vol) glycerol and 10 mM imidazole (buffer P) and lysed by sonication (SONOPULS mini20, BANDELIN electronic GmbH & Co. KG). Cell debris was removed by centrifugation at 40,000g for 45 min. For all proteins except for FDX2 the supernatant containing the soluble protein was subjected to Ni-NTA affinity chromatography (Prepacked His-Trap 5-ml FF crude column; GE Healthcare) and subsequent size exclusion chromatography (SEC; 16/60 Superdex 75 or 200; GE Healthcare) on an Äkta Purifier 10 system (GE Healthcare). For SEC and protein storage, the buffer was adjusted to 35 mM Tris-HCl pH 8, 150 mM NaCl and 5% (wt/vol) glycerol (buffer S). Elution from Ni-NTA matrix was achieved by applying a linear gradient from 0.01 to 1 M imidazole. Proteins typically eluted between 120 mM and 250 mM of imidazole.
Exceptions from the standard procedure: NFS1–ISD11–ACP1 complex proteins were co-expressed (NFS1 and ISD11 genes were inserted into pET-Duet MCSI and MCSII, respectively, and ACP1 into pRSF-Duet MCSI39, and co-purified using the His6-tag fused to ISD11 in buffer P additionally containing 5 mM PLP. Subsequently, the complex was purified to homogeneity by SEC in buffer S, and elution fractions contained a bright yellow protein. ISCU2 and variants were treated with EDTA, KCN and DTT before SEC to remove potentially bound metal ions and/or polysulfides. FXN was treated with self-made recombinant TEV protease, β-mercaptoethanol and DTT before SEC to cleave the N-terminal His6-tag (which renders the protein fully inactive) and to remove potential metal ion contaminations. FDX2 was purified using anion exchange chromatography and subsequent SEC. For anion exchange chromatography, 35 mM Tris-HCl pH 8 containing 20 mM NaCl (buffer A) was used. Elution was performed applying a linear gradient increasing the NaCl concentration from 0.02 M to 1.0 M. FDX2 typically eluted at a NaCl concentration of 150–300 mM. SEC was performed as outlined above and yielded a dark brown protein solution.
UV/Vis absorption spectroscopy was performed on a Jasco V550 (JASCO Deutschland). (NIA)2 or the (NIA)2-p.Cys381Ser variant was diluted to 25 µM or 50 µM in 250 µl of buffer, respectively, and either buffer (for measuring the initial ground state of the enzyme) or l-Cys or d-Cys was added to the sample to reach a final concentration of 5 mM. Stock solutions of Cys (100 mM) were buffered in 1 M Tris-HCl pH 8.0. To generate the (NIAX)2 or (NIAUX)2 complex, (NIA)2 was supplemented with two equivalents of either FXN or both FXN and ISCU2, respectively. Full spectra of the reaction mixtures were recorded approximately every 2 min at room temperature. Plots were created with Excel by plotting the absorption value of the indicated wavelength for each timepoint.
Persulfide transfer experiments (Supplementary Fig. 5) were done anaerobically at room temperature using degassed buffer T1 (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 5% wt/vol glycerol) in a final reaction volume of 20 µl. Reactions containing 20 µM (NIA)2 were initiated by addition of the indicated amounts of (pre-mixed) l-Cys and d-Cys (200 µM final Cys concentration). As a negative control, no Cys was added. Persulfidation was terminated after 10 s using 2.72 mM EZ-Link maleimide-PEG11-biotin (MPB, Thermo Scientific), that is, eight equivalents over total thiol concentration. After 20 s, SDS was added to a final concentration of 1% (wt/vol), and after another 10 min of incubation, samples were removed from the anaerobic chamber for analysis by SDS–PAGE (8% acrylamide gel). To this end, reaction aliquots containing 2 µg (NIA)2 were incubated in sample buffer with 50 mM TCEP for 15 min at room temperature. Gels were stained using InstantBlue (Expedeon, ISB1L) according to the manufacturer’s instruction.
Protein–Cys interactions were measured using microscale thermophoresis on a Monolith 1.15 (Nanotemper Technologies). Measurement settings were: LED power at 30% ((NIA)2 and (NIA)2-p.Cys381Ser), laser power at 75%, temperature fixed at 21 °C. Either (NIA)2 or (NIA)2 containing NFS1-p.Cys381Ser were labelled according to the manufacturer’s instructions (Monolith Protein Labeling Kit RED-NHS 2nd Generation, MO-L011, Nanotemper Technologies). Around 200 nM of labelled protein was titrated with a 1:1 dilution series of either l-Cys or d-Cys starting from 2 mM. Data were analysed using Origin 8 G (OriginLab Corporation).
Enzymatic reconstitution by the core ISC complex was followed by circular dichroism spectroscopy37,38 in reconstitution buffer (35 mM Tris pH 8.0, 150 mM NaCl, 0.8 mM sodium ascorbate, 0.3 mM FeCl2, 0.5 mM NADPH, 0.2 mM MgCl2), and 5 mM glutathione and 5 µM mouse Grx1 were added to the sample. Protein concentrations used were: 150 µM ISCU2; 5 µM each of FXN, FDX2, (NIA)2; 1 µM FDXR. The reaction was started by the addition of 3 µl of l-Cys or d-Cys or a mixture of both. Final concentration of Cys was adjusted to 1 mM. In the case of 10× and 20× excess of d-Cys, the concentration of l-Cys was adjusted to 0.5 mM and d-Cys was supplied to a final concentration of 5 mM and 10 mM, respectively, while the volume of added Cys was kept constant at 3 µl (see above).
Cysteine desulfurase activity of purified (NIA)2 and (NIA)2 with NFS1-p.Cys381Ser in complex with FXN and ISCU2 was determined by the DTT-dependent sulfide generation assay40,64 with minor modifications. In this non-physiological assay, purified protein was incubated at 30 °C in 25 mM tricine, pH 8.0, 1 mM DTT and 1 mM l-Cys or d-Cys. After 20 min, the reaction was stopped by addition of 4 mM N,N-dimethyl-p-phenylenediamine sulfate (in 7.2 N HCl) and 3 mM FeCl3 (in 1.2 N HCl). Samples were incubated for another 20 min in the dark and the amount of methylene blue was determined spectrophotometrically at 670 nm.
The (NIAU)2 complex was purified and concentrated to 17–20 mg ml−1 (ref. 38). l-propargylglycine (Sigma, 81838) was incorporated by incubation of purified (NIAU)2 complex with 1 mM l-propargylglycine on ice for 2 h.
Prepared (NIAU)2 complex was crystallized similarly to a published protocol38. Diffraction data were collected at the CMCF sector of the Canadian Light Source using a Pilatus 6M detector. The initial structure was obtained by molecular replacement method, within the PHENIX software package65 using PDB 6W1D coordinates as a starting model. The structure was refined using PHENIX65 and manually rebuilt with COOT66.
Cystathionine beta-synthase (CBS) activity was measured as described in ref. 67. The assay solution contained Tris-HCl (50 mM, pH 8.0), human recombinant CBS (1 µg per well), PLP (5 µM final concentration), SAM (100 µM final concentration) and the H2S-specific fluorescent probe 7-azido-4-methylcoumarin (AzMC,10 µM final concentration) in a 96-black flat-well plate format. The plates were incubated at 25 °C for 10 min, followed by CBS activity triggered by adding the substrates homocysteine (1 mM) and l-Cys or d-Cys (at increasing concentrations). The increase in the AzMc fluorescence in each well was read at an excitation of 365 nm and an emission of 450 nm (over a 2-h time course at 37 °C).
Eleven-week-old female immunodeficient mice (Athymic Nude-Foxn1nu) were obtained from Envigo (France) and housed in a pathogen-free environment at TransCure bioService (Archamps, France), at 55% ± 10% humidity and 22 °C ± 2 °C with a 12–12-h light–dark cycle (7:00:19:00). Water and food were provided at libitum. The mice were surgically engrafted into the mammary fat pad with 5 × 106 MDA-MB-231 tumour cells in 50% basement membrane matrix (Geltrex). When the average tumour volume reached approximately 50 mm3, mice were randomized and some were fed on a chow diet containing 6 g d-cystine and no l-cystine (Research Diets) and received an i.p. injection of 200 μl d-Cys (15 mg ml−1 in PBS, pH 7–7.4), between 8:00 and 9:00. Eight hours later, mice received a s.c. injection of 200 μl d-Cys (15 mg ml−1) or vehicle until euthanasia. Control mice were fed on the same diet as administered to the d-cystine-treated mice, except that l-cystine replaced d-cystine and that the control mice received i.p. and s.c. injection of PBS. All parenteral treatments were administered on Mondays to Fridays only. Mice were euthanized when the tumour volume reached 1,000 mm3. The experiment was stopped when a majority of the mice had to be euthanized according to ethical reasons in place at TransCure bioService, where all these experiments were performed. TransCure bioService is a Contract Research Organization and its authorization number for experiments on animals is DAP: 2022082413416895. Data collection and analysis were not performed blind to the conditions of the experiments. The technicians responsible for handling the mice were aware of the general nature of the treatments they administered but did not know their exact composition or intended effects.
Experiments to assess d-Cys plasma levels after i.p. or oral administration of d-Cys or d-cystine were performed at the Medical University of Geneva on 2-month-old female athymic nude-Foxn1nu mice (Envigo). Experiments were performed in accordance with the Institutional Animal Care and Use Committee of the University of Geneva and with permission of the Geneva cantonal authorities (authorization number GE14420).
The effects of d-Cys on body weight, creatinine and plasmatic levels of liver enzymes alanine aminotransferase and aspartate aminotransferase were assessed using adult nude mice treated for 28 days with d-Cys as described above. Experiments were performed at C3M, Inserm, Nice in accordance with the Animal Care and Use Committee (PEA804). Creatinine and liver enzymes were measured with a Cobas c 111 instrument.
Most data are presented as the mean ± s.d. Pairwise comparisons were performed by Student’s t-test, for multiple-comparisons ANOVA, and post hoc tests were applied as indicated. Dependent data were analysed using paired and repeated-measures methods. Data distribution was assumed to be normal, but this was not formally tested. For the in vivo experiments, comparisons of the tumour growth in control and d-Cys-treated mice were analysed by two-way ANOVA followed by Sidak’s multiple-comparisons test or unpaired two-tailed Student’s t-test. For animal survival analyses, Kaplan–Meier survival curves were analysed by log-rank (Mantel–Cox) test. One control mouse was found dead in its cage 2 days after treatment randomization. The tumour was poorly developed, and the cause of death was not further investigated. This animal was excluded from the final analysis.
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
The appeal and influence of Formula 1 has stretched far beyond the boundaries of the world’s race tracks over the last 75 years, with the sport, its drivers and teams appearing in a plethora of different media.
From films and TV series, to music videos, adverts and everything else in between, there’s been no shortage of inspiration taken from the championship over the last seven-and-a-half decades.
Here are 20 unlikely times that F1 appeared elsewhere in the last 75 years…
Released in 2006, the film Cars follows rookie racer Lightning McQueen as he attempts to win the Piston Cup and put his name amongst the greats via the usual trials and tribulations that are the cornerstone of most Disney films.
The film is a favourite of many F1 fans, as well as Racing Bulls driver Liam Lawson, in part due to the motorsport greats that lend their voices to the film, with voiceovers from 1978 Formula 1 World Champion Mario Andretti, and NASCAR legends Richard Petty and Dale Earnhardt Jr.
Perhaps the most memorable cameo, though, is by seven-time F1 World Champion Michael Schumacher, whose Ferrari character makes an appearance in the shop of hardcore Tifosi, Luigi and Guido.
This would also not be the last time other notable F1 drivers cropped up in the franchise, with the likes of Lewis Hamilton, Fernando Alonso and Sebastian Vettel supplying their voices in the sequels.
Lewis Hamilton’s interest in fashion has become well-known through his collaborations with Tommy Hilfiger and numerous appearances at the infamous Met Gala, where he has sported some truly show-stopping attire.
Before all that, though, the seven-time World Champion appeared in the 2016 film Zoolander 2, making a cameo appearance as a member of the audience during a model catwalk scene.
Quite what the Briton made of Ben Stiller and Owen Wilson being covered in prune juice is anyone’s guess, but it clearly didn’t dissuade Hamilton’s appetite for Hollywood, having taken on a producer role for F1 The Movie, which was released last month.
The Marvel franchise has become one of the biggest brands across the globe, its rise in popularity and run of countless movies stemming from the successful release of Iron Man in 2008.
The film’s sequel two years later, while not as well-received, is famous with motorsport fans due to its racing scene at the Monaco Historique where Tony Stark, played by Robert Downey Jr, gets behind the wheel.
Having commandeered his own Stark-sponsored car on the starting grid, and much to the disgust of regular driver ‘Defilipo’, Stark proceeds to race around the streets of Monte Carlo until attacked by arch-nemesis, Whiplash, who enters the track after posing as a marshal.
It makes for an eye-catching and memorable scene for motorsport fans on the streets of the Principality.
A story about a man confined to an airport may well be one of the most unlikely of places anyone might expect to see a reference about Formula 1, but Steven Spielberg’s The Terminal, released in 2004, does just that.
Viktor Navorski, played by Academy Award-winner Tom Hanks, finds himself stranded in an American airport and without citizenship due to a coup back home in his native Krakozhia.
It leads to a scene with Navorski walking around his new but unconventional home in a bathrobe before heading to the bathroom, where he dons an Ayrton Senna McLaren towel no less.
It’s anyone’s guess where Hanks’ character got the piece of F1 memorabilia or indeed what would happen to it, but no doubt the item would now be a treasured piece of merchandise.
Famous for being arguably the greatest driver never to win the Formula 1 World Championship, Sir Stirling Moss’ passion for motorsport never diminished, even in his later years.
A 16-time Grand Prix winner as well as famously taking victory in the 1955 Mille Miglia, Moss also added narration to his résumé as he lent his voice to children’s television programme, Roary the Racing Car.
Running across two seasons and 104 episodes between 2007 and 2010, Moss described it as “a jolly good entertaining programme. I got involved in the show because I thought it was fun. It was nice for children, I’ve got grandchildren myself who, whenever they listen to it, they say, ‘There’s grandpa’.”
The music video for Robbie Williams’ song, Supreme, may have got a few more fans in the year 2000 thanks to its use of historical F1 footage, in particular the early 1970s and three-time World Champion, Jackie Stewart.
The singer plays the role of ‘Bob Williams’, with the video charting his quest to beat Stewart for the F1 World Championship, including escaping injury from a serious accident, victories and ultimately missing the championship decider after getting locked in a caravan!
Complete with period sideburns, Williams appears in several of his own scenes but is also super imposed alongside Stewart and Tyrrell team mate Francois Cevert on the podium, in some green screen work that even today looks just about passable!
Romain Grosjean achieved 10 podiums during an F1 career spanning more than a decade, although it’s unclear if the Frenchman counts an unofficial rostrum finish that occurred during a David Guetta music video.
Guetta plays an F1 driver for his aptly named song, Dangerous, and goes head-to-head with his rival, played by actor James Purefoy, in a championship showdown at the Jerez Circuit with the help of a 2012 Lotus E20 F1 car, alongside what appears to be Formula Renault machines.
Guetta ultimately proves victorious before being joined on the podium by Purefoy and a confused-looking Grosjean, who appears gracious with third-place, while probably wondering why he’s been dragged into the mix at all.
A collaboration between the Alpine F1 team and Amazon Music meant that Pierre Gasly appeared in the music video for Benson Boone’s To Love Someone while at the Mexico City Grand Prix.
After being doorstepped, although presumably having been told it was going to happen, the one-time Grand Prix winner agrees to appear in the video, which is filmed in the hotel’s gym and children’s playroom area, because why not?
The video’s narrative is of a ‘bromance’ between the two before Gasly’s fame means they drift apart, leading to an interesting final result…
Formula 1 drivers appearing in adverts and promoting products from engine oil and cars, to watches and even milk is nothing new, and the practice stretches as far back as the inauguration of the championship.
Two-time World Champion Jim Clark was no stranger to the concept, appearing in an advert for the British School of Motoring during the 1960s.
The Scot, who won 27 Grands Prix as well as the Indianapolis 500 all with Lotus, died in an F2 accident at Hockenheim in 1968 just as major tobacco sponsorship entered the sport and heralded a new era of F1 driver advertisements and endorsements.
With five F1 world titles to his name for four different manufacturers during the inaugural decade of the championship, it’s little wonder Juan Manuel Fangio is referred to as ‘El Maestro’.
The Argentinian retired from racing in 1958 at the age of 47 but Fangio would still continue to showcase his prowess behind the wheel through demonstration runs over the following decades, including in adverts.
In one, for Pirelli’s Cinturato tyre, Fangio – attired with leather gloves, goggles and a tie – takes the wheel of an Alfa Romeo on Monza’s high-speed banking at racing speeds and rolls back the years.
With World Championship success comes added media attention and a plethora of endorsements, as proved to be the case for James Hunt, although the 1976 Champion already had quite the portfolio beforehand thanks to his playboy lifestyle and charismatic persona.
The season after his title success, Hunt found himself in an advert for Texaco oil, a prominent sponsor for McLaren during the Briton’s tenure with the team.
Throw into the mix British comedic duo Morecambe and Wise, some quick-witted one-liners and an F1 World Champion trying to contain a laugh while being slapped, and an unforgettable sketch was born.
Prior to his full-time F1 racing career that would yield 31 wins and the 1992 World title, Nigel Mansell patrolled the streets of the Isle of Man as a police officer – and based on an advert from the 1980s, tried his hand as a bus driver briefly.
Attired in his Williams overalls, Mansell takes to the wheel of a double-decker bus around London, which presumably handled better than some of the racing cars he drove in his career.
By their nature, Formula 1 drivers are competitive beings even away from the racetrack and in their day-to-day lives.
That was certainly the case for Mansell (appearing on this list again), who in between his busy F1 schedule finds time to race against his son, Leo, on the latest Formula Tyco set. Complete with Murray Walker commentary, Mansell comes off second best in this blast from the past advert.
Long before Esports, high-end graphics and EA’s F1 game franchise, racing games looked very different but still proved popular, and Ayrton Senna’s Super Monaco GP II was no different.
Released in 1992 by Sega for the Sega Genesis, the game revolved around the 1991 season, the year which produced the third and final F1 title for the Brazilian.
Senna himself was involved in the game’s development, offering his insight into various elements of the gameplay, recording voicelines and even featuring in an advert that was used in Japan.
It wasn’t the only racing game to hit the shelves that year endorsed by an F1 driver either, as Mansell also backed his own World Championship Racing title – although that one was advertised by British comedian Rik Mayall wearing a false moustache and eyebrows…
With his exuberance and sheer passion for the sport, Murray Walker became a well-loved mainstay for many in his role as a commentator.
His love of Formula 1 unsurprisingly helped him form close friendships with several drivers, not least co-commentators James Hunt and Martin Brundle, but also Damon Hill – and his 1996 Japanese Grand Prix commentary (“I’ve got a lump in my throat”) revealed the deep connection the two had.
It’s not surprising then that the pair teamed up for a Pizza Hut commercial in the late 1990s, Murray bringing his usual excitement and wit, while Hill makes the disturbing decision of eating a slice of pizza… backwards!
Ferrari is synonymous with Formula 1, the Italian marque having been involved in the championship every year since the inaugural season 75 years ago.
Through all the highs and just as many lows that have both blessed and plagued Ferrari, Shell has been there as a partner for more than seven decades. It’s perhaps fitting then that the fuel corporation launched an advert in the mid-2000s celebrating its collaboration with Ferrari in F1.
Cars throughout Ferrari’s history are showcased as they take to the streets in Rome, New York and Monte Carlo, creating one of the most memorable motorsport adverts of all time.
The fractious battle between two-time and reigning World Champion Fernando Alonso and F1 rookie Lewis Hamilton during their one season together in 2007 as team mates at McLaren has gone down in infamy.
It’s perhaps ironic then, that the pair filmed a commercial for Mercedes where their competitive nature came to the fore even before their relationship broke down.
Edited to the tune of Anything You Can Do (I Can Do Better), the pair compete to be the first to do menial, day-to-day tasks, foreshadowing the intense intra-team battle that was to come that season as both missed out on the Drivers’ Championship by a single point – ultimately losing out to a Finn in both the advert (Mika Hakkinen) and the 2007 championship (Kimi Raikkonen).
Driving solo around an in-door go-kart track, avoiding scattered milk cartons and proceeding to sing an out of tune melody probably doesn’t rank that high on Mark Webber’s list of accolades.
Yet the ex-F1 driver, who would claim nine Grand Prix victories with Red Bull, including two at the Monaco Grand Prix, performed just such an advert.
It’s not clear whether Webber has erased all existence of the ad from his memory, but thankfully the clip remains available to view with the help of YouTube.
F1 drivers appearing in video games is nothing new, especially given the officially licensed racing games that have been released on a yearly basis.
But what is less common is for F1 drivers to appear in other genres of video games, not least the Call of Duty franchise. Eagle-eyed gamers will have noticed that Lewis Hamilton makes an appearance in Call of Duty: Infinite Warfare as engineer Carl Hamilton, having been scanned into the game as well as delivering voiceovers.
The Dragon Ball franchise is not only one of the biggest in Japan but also globally through its manga and anime releases, predominantly during the 1980s and 1990s.
Main protagonist Goku even appeared as an ambassador for the 2020 Olympic Games in Tokyo, so it’s no surprise that the franchise became involved with F1 for a time.
Back in 1990, creator Akira Toriyama travelled to Germany to meet Ayrton Senna and a collaboration developed over the season, with several pieces of artwork featuring Goku in McLaren gear created, while manga publication Shonen Jump featured as a sponsor on the team’s MP4/5 at the Japanese Grand Prix.
Cardiovascular disease (CVD) represents the leading cause of mortality and morbidity globally, accounting for approximately 30% of all disease-related deaths each year.1 Acute coronary syndrome (ACS) is one of the most lethal subtypes of coronary heart disease, requiring timely risk assessment and effective therapeutic interventions to improve patient outcomes.2 Advances in medical techniques, particularly the widespread use of percutaneous coronary intervention (PCI), have significantly reduced mortality of ACS.3,4 However, the major adverse cardiovascular events (MACEs) after PCI continue to threaten the health and quality of life of ACS patients.5,6 Therefore, identifying biomarkers that can improve early diagnosis and predict the prognosis of ACS remains an urgent priority.7
Exosomes are small extracellular vesicles, with dimensions ranging from 30 to 150 nm, secreted by nearly all cell types. They function as cargo transporters, transferring nucleic acid, proteins, lipids, and other stuffs between cells.8 Exosomes are integral to numerous biological processes and the pathogenesis of various diseases.9 The process of exosome biogenesis enables the packaging of molecules from both membranous and cytosolic origins, making them reflective of the state of the releasing cell and providing valuable insights into the cellular environment. The encapsulation of proteins and RNAs within exosomes prevents their degradation, making exosomes an ideal source of biomarkers. Advances in exosome isolation techniques have garnered significant attention for their potential in clinical applications. Increasing evidence supports the potential of exosomes as valuable biomarkers for early diagnosis and prognosis assessment in cardiovascular diseases.10
MALAT1-associated small cytoplasmic RNA (mascRNA) originates from the nuclear long non-coding RNA MALAT1, is a tRNA-like small non-coding RNA, and is localized in the cytoplasm.11 While MALAT1 has been extensively studied and shown to influence various cellular processes, including the development of atherosclerosis,12,13 the function of mascRNA remains largely unknown. Recent research has detected high levels of mascRNA in circulating human peripheral blood mononuclear cells (PBMCs).14 MascRNA suppresses the production of inflammatory cytokines in LPS-stimulated macrophages by inhibiting the activation of NF-κB and MAPK signaling pathways.15 In murine models of atherosclerosis, mascRNA deficiency leads to hyperactivity of circulating inflammatory cells and an increased macrophage presence in atherosclerotic plaques, contributing to plaque rupture and thrombosis formation.16 However, the expression of mascRNA in circulating exosomes remains poorly understood.
Our previous study demonstrated that MALAT1 may serve as a promising biomarker for cardiovascular disease, showing diagnostic potential for ACS patients.17 However, limited research has evaluated the diagnostic value of mascRNA in cardiovascular disease. This study aims to explore the link between plasma-derived exosomal mascRNA and the occurrence of ACS and its association with adverse cardiovascular events.
This study included 281 patients who underwent coronary angiography at Meizhou People’s Hospital from Oct. 2021 to May 2024. The ACS patients were diagnosed according to the 2020 ESC Guidelines for managing acute coronary syndromes,18 which were characterized by symptoms such as recurrent chest pain at rest or with minimal exertion, as well as severe angina that began or worsened within 4 weeks before the procedure. The exclusion criteria included severe valvular heart disease, severe arrhythmias, acute or chronic inflammation, malignant tumors, autoimmune diseases, and hematologic disorders. The non-ACS group included individuals who were diagnosed without coronary artery disease (CAD) by cardiologists as coronary angiography indicative of stenosis < 50%. This research was approved by the Ethical Committee of Meizhou People’s Hospital (Approval No. MPH-HEC 2023-C-34) and was conducted in full accordance with the principles of the Declaration of Helsinki. Informed written consent was collected from each participant. Figure 1 illustrates the study flow.
|
Figure 1 Study flow diagram.
|
A total of 5 mL of venous blood was obtained from patients prior to PCI and placed in EDTA anticoagulant tubes. The samples were maintained at 4°C for 2 hours. Subsequently, the samples were centrifuged at 300g for 10 minutes, after which the supernatant was collected and aliquoted into centrifuge tubes for exosome isolation.
Exosomes were isolated from plasma by ultracentrifugation techniques (CP100NC, Hitachi), as shown in Figure 2A. In brief, the plasma was subjected to centrifugation at 2000g for 10 minutes, after which the supernatant was collected. This was followed by centrifugation at 10,000g for 30 minutes, and the supernatant was again collected. Subsequently, the sample was centrifuged at 120,000g for 30 minutes, and the supernatant was carefully discarded. The resulting pellet was resuspended in PBS and centrifuged once more at 120,000g for 30 minutes. The supernatant was discarded, leaving the exosomes at the bottom for subsequent experiments. All centrifugation procedures were performed at 4°C.
 |
Figure 2 Isolation and characterization of exosomes from plasma. (A) Centrifugation protocol for enrichment of plasma exosomes; (B) Transmission electron microscopy (TEM) analysis of the exosome morphology. Representative exosomes are indicated by arrows; (C) The particle size of exosomes was measured by nanoparticle tracking analysis. (D) Western blot analysis of the exosomal markers.
|
The exosomes derived from plasma were characterized using nanoparticle tracking analysis (NTA), Western blotting, and transmission electron microscopy (TEM). For the Western blot analysis, the exosomes were probed with the following primary antibodies: anti-CD9 (1:1000, Cell Signaling Technology), anti-CD63 (1:1000, Cell Signaling Technology), and anti-TSG101 (1:1000, Cell Signaling Technology). The NTA was conducted using a NanoSight NS300 instrument (Malvern Panalytical) to evaluate the size, distribution, and concentration of the exosomes. TEM was performed with a JEM-1400 microscope (JEOL, Japan) to examine the ultrastructural features and size of the exosomes.
Exosomal RNA was extracted utilizing the SteadyPure Small RNA Extraction Kit (Accurate Biology, China). RNA quality was assessed by measuring the A260/A280 ratio with an ultramicro-spectrophotometer (NP80, IMPLEN, Germany). Complementary DNA (cDNA) was generated by PrimeScript™ RT reagent Kit (Takara, Japan). Exosomal mascRNA expression was determined utilizing the TB Green® Premix Ex Taq™ II and normalized to U6 using the 2−ΔΔCt method.19 The primer sequences for qRT-PCR were as follows:
mascRNA forward, 5’-GATGCTGGTGGTTGGCACTC-3’; mascRNA reverse, 5’-TGGAGACGCCGCAGGGAT-3’; U6 forward, 5’-CTCGCTTCGGCAGCACA-3’; U6 reverse, 5’-AACGCTTCACGAATTTGCGT-3’.
The clinical characteristics of patients were retrieved from the hospital’s electronic medical records. Collected variables included age, gender, hypertension, diabetes mellitus, dyslipidemia, left ventricular ejection fraction (LVEF), blood pressure, glucose levels, lipid profiles and blood cell counts.
One-year follow-up data for ACS patients were obtained from electronic medical records or through telephone interviews. The primary outcome measure was the incidence of major adverse cardiovascular events (MACE) including all-cause mortality, nonfatal myocardial infarction, target vessel revascularization, rehospitalization for angina or heart failure, and stent thrombosis.
Statistical analyses were conducted using SPSS 20.0 (IBM Corp., Armonk, NY, USA). Data were presented as mean ± SD or number (percentage). The Shapiro–Wilk test checked the normality of continuous variables. Student’s t-test was used for continuous variables, and chi-square or Fisher’s exact test for categorical variables. The sample size, based on China’s ACS incidence of 1%, is approximately 95, with a significance level of α = 0.05 and a 2% margin of error. The correlation between exosomal mascRNA and clinical parameters were analyzed by Spearman correlation analysis. Logistic multivariate regression analysis was employed to assess the relationship between exosomal mascRNA and ACS risk. Receiver operating characteristic (ROC) curve analysis was employed to evaluate the diagnostic value of exosomal mascRNA for ACS. The one-year MACE-free survival was assessed using Kaplan–Meier analysis and the Log rank test, while multivariable Cox regression identified predictors of 1-year MACEs in ACS patients. A P-value < 0.05 was considered statistically significant.
The study included 140 ACS patients and 141 non-ACS, with baseline characteristics summarized in Table 1. There was no difference between the two groups regarding gender, age, hypertension, diabetes mellitus, and dyslipidemia. ACS patients exhibited higher levels of white blood cell (WBC), monocytes, neutrophils, Gensini scores, cTnI (P < 0.05), and lower LVEF compared to non-ACS group (P < 0.05).
 |
Table 1 Baseline Characteristics of Study Subjects
|
Plasma exosomes were isolated utilizing multiple ultracentrifugation steps (Figure 2A). Plasma exosomes exhibited a typical double-layered vesicular structure (Figure 2B), with a mean diameter of approximately 130 nm (Figure 2C). Western blot analysis verified the expression of exosomal protein markers CD9, TSG101 and CD63 (Figure 2D).
Our data suggested that exosomal mascRNA expression was elevated in ACS patients compared to the non-ACS (Figure 3A). However, exosomal mascRNA expression showed no significance between the subgroups of ACS (Figure 3B).
 |
Figure 3 The expression of exosomal mascRNA in patients with ACS. (A) Exosomal mascRNA levels in ACS patients and non-ACS patients. **P < 0.01, comparison was tested by Student’s t test; (B) Exosomal mascRNA levels in different types of ACS patients. (C) Comparison of exosomal mascRNA expression in ACS patients with MACE and non-MACE during the one-year follow-up. *P < 0.05, comparison was tested by Student’s t test.
|
We compared the expression of exosomal mascRNA in patients with or without MACEs during the 1-year follow-up period after PCI treatment. A total of 29 ACS patients developed MACEs during the follow-up. Our data showed that mascRNA expression was significantly higher in the MACE group than the non-MACE group (Figure 3C).
We further analyzed the association between exosomal mascRNA and clinical parameters. As shown in Figure 4, the Spearman correlation analysis revealed a significant positive correlation between exosomal mascRNA levels and Gensini scores (r = 0.242, P < 0.001), LDL (r = 0.173, P = 0.019), WBC (r = 0.183, P = 0.012), age (r = 0.164, P = 0.013). No significant associations were observed between exosomal mascRNA levels and LVEF (r = −0.120, P = 0.103), neutrophil count (r = 0.100, P = 0.109), as these differences did not reach statistical significance.
 |
Figure 4 Correlation between exosomal mascRNA and clinical parameters. The correlation between exosomal mascRNA and age (A), LVEF (B), Gensini score (C), LDL level (D), WBC (E), and neutrophil (F) was assessed by Spearman correlation analysis.
|
The diagnostic value of exosomal mascRNA for ACS was evaluated by ROC curve analysis. Our data revealed that exosomal mascRNA serves as a diagnostic predictor for ACS, with an AUC of 0.763 (95% CI: 0.702–0.824) and cutoff value of 1.173 (Figure 5). The predictive performance of mascRNA improved when combined with cTnI, with the AUCs increased to 0.866 (95% CI: 0.815–0.916) (Figure 5).
 |
Figure 5 The diagnostic value of exosomal mascRNA for ACS.
|
To illustrate the association of the exosomal mascRNA with ACS risk, its levels were categorized into quartiles (35 patients for each quartiles). Compared with patients in the first quartile for mascRNA expression, patients in the second, third and fourth quartiles exhibited increased ACS risk (OR: 3.423, 95% CI: 1.427–8.213, OR: 5.542, 95% CI: 1.859–16.524 and OR: 9.288, 95% CI: 3.275–26.340, respectively; all P < 0.01; Table 2).
 |
Table 2 Association Between Exosomal mascRNA Expression and Risk of ACS
|
We further explored whether the expression of exosomal mascRNA predict the occurrence of MACEs. Patients were divided into high mascRNA group (≥ 3.85, n = 60) and low mascRNA group (< 3.85, n = 60). Kaplan-Meier analysis and Log rank test were utilized to assess the 1-year MACEs‐free survival rate between high mascRNA and low mascRNA groups. The data revealed that patients with high mascRNA expression have a lower incidence of MACE-free survival compared to those with low mascRNA expression (long rank P < 0.001) (Figure 6).
 |
Figure 6 The prognostic value of exosomal mascRNA in patients ACS. The 1-year MACEs‐free survival rate between high mascRNA and low mascRNA groups was assessed by Kaplan-Meier curves.
|
A multivariate Cox regression analysis was performed to determine association between exosomal mascRNA and MACEs in ACS patients. After adjusted for age, diabetes mellitus and LVEF, mascRNA was significantly associated with the occurrence of 1-year MACEs, with a HR of 2.959 (95% CI: 1.187–4.669, P < 0.001) (Tables 3 and 4).
 |
Table 3 Clinical Characteristics of Non-MACE and MACE Group in ACS Individuals
|
 |
Table 4 Multivariate Cox Regression Model Analysis of MACEs in ACS Patients
|
ACS is still the leading cause of mortality despite the advances in treatment and diagnostic modalities.2 Precise diagnosis of ACS is crucial for effective therapeutic intervention and enhancing patient survival rates. The study found that exosomal mascRNA levels were significantly higher in ACS patients and closely linked to ACS risk, suggesting its potential as a diagnostic and prognostic biomarker.
Cardiac troponin (cTnI) is the key plasma biomarker for detecting myocardial injury, with high sensitivity and specificity for diagnosing acute myocardial infarction (AMI). However, its specificity is low in the first 3 hours after symptoms begin, and elevated levels can also indicate other conditions such as myocarditis and stress-induced cardiomyopathy.20,21 Exosomes have attracted increasing interest in the cardiovascular field due to their potential clinical implications. More and more exosome-based biomarkers are identified for diagnosis of cardiovascular diseases.22–25 This study found that exosomal mascRNA levels were significantly higher in ACS patients, regardless of the type of ACS (UA, STEMI, or NTEMI), and were linked to an increased risk of ACS. MascRNA levels correlated with the Gensini score, LDL, and WBC, which are related to vascular stenosis, inflammation, and lipid metabolism. Notably, although the findings are significant, the correlations are weak, thus more studies would be needed to validate the clinical relevance of mascRNA.
MascRNA is a highly conserved small non-coding RNA originating from the primary transcript of MALAT1.11 As one of the most abundant lncRNAs, MALAT1 has been established as a crucial regulator in cardiovascular pathological processes.26–28 Our previous study as well as studies of others suggested that MALAT1 was enriched in exosomes and serve as potential biomarker for coronary heart disease.29,30 To the best of our knowledge, this study is the first to identify the expression of mascRNA in plasma exosomes. Our data suggested that exosomal mascRNA could distinguish ACS from non-ACS individuals, achieving an AUC of 0.776. Notably, the combination of mascRNA and cTnI markedly enhanced diagnostic performance, achieving an AUC of 0.884, surpassing the efficacy of either marker alone and underscoring its clinical utility. Further investigation is warranted to assess the optimal integration of mascRNA with other established or emerging biomarkers to improve the specificity and accuracy of ACS diagnosis.
The prediction of major adverse cardiovascular events (MACE) is crucial for optimizing treatment strategies in patients with acute coronary syndrome (ACS). Numerous inflammatory biomarkers, such as C-reactive protein (CRP), the neutrophil-lymphocyte ratio (NLR), the fibrinogen/albumin ratio (FAR), and the systemic immune-inflammation index (SII), are gaining prominence in research due to their cost-effectiveness, simplicity, and ease of application.31–33 Although these inflammatory biomarkers demonstrated a strong correlation with the occurrence of major adverse cardiovascular events (MACEs), their specificity remains problematic. Consequently, predictive biomarkers for MACEs are still limited.34 This study found that patients with high exosomal mascRNA levels experienced a higher rate of MACEs within a year after PCI treatment, with mascRNA being an independent risk factor (HR = 3.357). This suggests a link between mascRNA and ACS outcomes. While the typical MACE incidence post-PCI is around 10%, our one-year follow-up showed a 20.7% rate (29/140), possibly due to the MACE criteria and the predominance of AMI among ACS patients.
Although the exact mechanisms underlying how mascRNA participated in the pathology of ACS remained unclear, some research suggested that it is in part due to its function on inflammation. Sun et al35 reported that mascRNA inhibits the activation of NF-κB and MAPK signaling, as well as the production of inflammatory cytokines in macrophages stimulated by LPS. Gast et al16 found that selective ablation of mascRNA resulted in massive induction of TNF and IL-6 in macrophages, which significantly exacerbated vascular injury compared to wildtype macrophages. Previous studies have shown that endothelial dysfunction is linked to future MACEs. Endothelial dysfunction is a key factor in myocardial infarction and central to all ACS, contributing to atherosclerosis through vasoconstriction, macrophage migration, cellular growth, and inflammation.36–38 Our prior research indicated that MALAT1 inhibits endothelial inflammation and the interactions between monocytes and endothelial cells through ATG5-mediated autophagy.13 Since mascRNA is closely associated with MALAT1, mascRNA may also participate in the regulation of endothelial inflammation. Nonetheless, additional investigations are required to elucidate the underlying mechanisms.
This study is subject to several limitations. Firstly, as a single-center investigation with a relatively small sample size and a retrospective design, it is vulnerable to information and selection biases. Consequently, multicenter cohort studies are required to validate our findings. Secondly, this study did not include a comparison of mascRNA levels before and after patient treatment. Future research should assess the changes in mascRNA expression pre- and post-treatment to explore its predictive value for MACEs.
In summary, exosomal mascRNA levels were elevated in the plasma of ACS patients and demonstrated significant diagnostic value for ACS. Furthermore, exosomal mascRNA demonstrated a significant association with the incidence of MACEs in patients ACS, indicating its potential utility as an independent predictor of adverse clinical outcomes.
ACS, Acute coronary syndrome; cDMA, Complementary DNA; CVD, Cardiovascular disease; LVEF, Left ventricular ejection fraction; MACEs, Major adverse cardiovascular events; mascRNA, MALAT1-associated small cytoplasmic RNA; NTA, Nanoparticle tracking analysis; PBMCs, Peripheral blood mononuclear cells; PCI, Percutaneous coronary intervention; qRT-PCR, Reverse transcription-quantitative polymerase chain reaction; ROC, Receiver operating characteristic; TEM, Transmission electron microscopy; WBC, White blood cell.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
This research was granted by the Ethical Committee of Meizhou People’s Hospital (MPH-HEC 2023-C-34).
All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
This study was supported by China Foundation for Youth Entrepreneurship and Employment (P24032887714); Guangdong Basic and Applied Basic Research Foundation (2022A1515011860 and 2022A1515012590); Medical Research Foundation of Guangdong Province (A2023154); State Key Laboratory of Neurology and Oncology Drug Development (SKLSIM-F-202412).
The authors declare that they have no competing interests in this work.
1. Ralapanawa U, Sivakanesan R. Epidemiology and the magnitude of coronary artery disease and acute coronary syndrome: a narrative review. J Epidemiol Glob Health. 2021;11(2):169–177. doi:10.2991/jegh.k.201217.001
2. Bergmark BA, Mathenge N, Merlini PA, Lawrence-Wright MB, Giugliano RP. Acute coronary syndromes. Lancet. 2022;399(10332):1347–1358. doi:10.1016/s0140-6736(21)02391-6
3. Bhatt DL, Lopes RD, Harrington RA. Diagnosis and treatment of acute coronary syndromes: a review. JAMA. 2022;327(7):662–675. doi:10.1001/jama.2022.0358
4. Kondo Y, Ishikawa T, Shimura M, et al. Cardiovascular outcomes after paclitaxel-coated balloon angioplasty versus drug-eluting stent placement for acute coronary syndrome: a systematic review and meta-analysis. J Clin Med. 2024;13(5):1481. doi:10.3390/jcm13051481
5. Kuno T, Kiyohara Y, Maehara A, et al. Comparison of intravascular imaging, functional, or angiographically guided coronary intervention. J Am Coll Cardiol. 2023;82(23):2167–2176. doi:10.1016/j.jacc.2023.09.823
6. Gall E, Mafi D, Ghannam T, et al. Percutaneous coronary intervention in out-of-hospital cardiac arrest related to acute coronary syndrome: a literature review. J Clin Med. 2023;12(23):7275. doi:10.3390/jcm12237275
7. Ahmed TAN, Johny JS, Abdel-Malek MY, Fouad DA. The additive value of copeptin for early diagnosis and prognosis of acute coronary syndromes. Am J Emerg Med. 2021;50:413–421. doi:10.1016/j.ajem.2021.08.069
8. Zhang Z, Zou Y, Song C, et al. Advances in the study of exosomes in cardiovascular diseases. J Adv Res. 2023;66:133–153. doi:10.1016/j.jare.2023.12.014
9. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478):eaau6977. doi:10.1126/science.aau6977
10. Wang C, Li Z, Liu Y, Yuan L. Exosomes in atherosclerosis: performers, bystanders, biomarkers, and therapeutic targets. Theranostics. 2021;11(8):3996–4010. doi:10.7150/thno.56035
11. Skeparnias I, Bou-Nader C, Anastasakis DG, et al. Structural basis of MALAT1 RNA maturation and mascRNA biogenesis. Nat Struct Mol Biol. 2024;31(11):1655–1668. doi:10.1038/s41594-024-01340-4
12. Yan Y, Song D, Song X, Song C. The role of lncRNA MALAT1 in cardiovascular disease. IUBMB Life. 2020;72(3):334–342. doi:10.1002/iub.2210
13. Gu X, Hou J, Rao J, Weng R, Liu S. LncRNA MALAT1 suppresses monocyte-endothelial cell interactions by targeting miR-30b-5p and enhancing ATG5-mediated autophagy. Heliyon. 2024;10(7):e28882. doi:10.1016/j.heliyon.2024.e28882
14. Gast M, Schroen B, Voigt A, et al. Long noncoding RNA MALAT1-derived mascRNA is involved in cardiovascular innate immunity. J Mol Cell Biol. 2016;8(2):178–181. doi:10.1093/jmcb/mjw003
15. Gast M, Nageswaran V, Kuss AW, et al. tRNA-like transcripts from the NEAT1-MALAT1 genomic region critically influence human innate immunity and macrophage functions. Cells. 2022;11(24):3970. doi:10.3390/cells11243970
16. Gast M, Rauch BH, Nakagawa S, et al. Immune system-mediated atherosclerosis caused by deficiency of long non-coding RNA MALAT1 in ApoE-/-mice. Cardiovasc Res. 2019;115(2):302–314. doi:10.1093/cvr/cvy202
17. Liu S, Hou J, Gu X, Weng R, Zhong Z. Characterization of LncRNA expression profile and identification of functional LncRNAs associated with unstable angina. J Clin Lab Anal. 2021;35(11):e24036. doi:10.1002/jcla.24036
18. Collet JP, Thiele H, Barbato E, et al. 2020 ESC Guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation. Eur Heart J. 2021;42(14):1289–1367. doi:10.1093/eurheartj/ehaa575
19. Xie SJ, Diao LT, Cai N, et al. mascRNA and its parent lncRNA MALAT1 promote proliferation and metastasis of hepatocellular carcinoma cells by activating ERK/MAPK signaling pathway. Cell Death Discov. 2021;7(1):110. doi:10.1038/s41420-021-00497-x
20. McCann CJ, Glover BM, Menown IB, et al. Novel biomarkers in early diagnosis of acute myocardial infarction compared with cardiac troponin T. Eur Heart J. 2008;29(23):2843–2850. doi:10.1093/eurheartj/ehn363
21. Crutchfield CA, Thomas SN, Sokoll LJ, Chan DW. Advances in mass spectrometry-based clinical biomarker discovery. Clin Proteomics. 2016;13(1):1. doi:10.1186/s12014-015-9102-9
22. Sahoo S, Adamiak M, Mathiyalagan P, Kenneweg F, Kafert-Kasting S, Thum T. Therapeutic and diagnostic translation of extracellular vesicles in cardiovascular diseases: roadmap to the clinic. Circulation. 2021;143(14):1426–1449. doi:10.1161/circulationaha.120.049254
23. Matsumoto S, Sakata Y, Suna S, et al. Circulating p53-responsive microRNAs are predictive indicators of heart failure after acute myocardial infarction. Circ Res. 2013;113(3):322–326. doi:10.1161/circresaha.113.301209
24. Kuwabara Y, Ono K, Horie T, et al. Increased microRNA-1 and microRNA-133a levels in serum of patients with cardiovascular disease indicate myocardial damage. Circ Cardiovasc Genet. 2011;4(4):446–454. doi:10.1161/circgenetics.110.958975
25. Cheng M, Yang J, Zhao X, et al. Circulating myocardial microRNAs from infarcted hearts are carried in exosomes and mobilise bone marrow progenitor cells. Nat Commun. 2019;10(1):959. doi:10.1038/s41467-019-08895-7
26. Cremer S, Michalik KM, Fischer A, et al. Hematopoietic deficiency of the long noncoding RNA MALAT1 promotes atherosclerosis and plaque inflammation. Circulation. 2019;139(10):1320–1334. doi:10.1161/CIRCULATIONAHA.117.029015
27. Michalik KM, You X, Manavski Y, et al. Long noncoding RNA MALAT1 regulates endothelial cell function and vessel growth. Circ Res. 2014;114(9):1389–1397. doi:10.1161/CIRCRESAHA.114.303265
28. Ding A, Li CH, Yu CY, Zhou HT, Zhang ZH. Long non-coding RNA MALAT1 enhances angiogenesis during bone regeneration by regulating the miR-494/SP1 axis. Lab Investigation. 2021;101(11):1458–1466. doi:10.1038/s41374-021-00649-8
29. Gu X, Hou J, Weng R, Rao J, Liu S. The diagnosis and prognosis value of circulating exosomal lncRNA MALAT1 and LNC_000226 in patients with acute myocardial infarction: an observational study. Immun Inflamm Dis. 2024;12(12):e70088. doi:10.1002/iid3.70088
30. Liu Q, Sheng X, Chen Q. Killing three birds with one stone: lncRNA MALAT1 as a multifunctional biomarker in atherosclerotic cardiovascular disease. Biomarker Med. 2021;15(14):1199–1200. doi:10.2217/bmm-2021-0326
31. Lee GK, Lee LC, Chong E, et al. The long-term predictive value of the neutrophil-to-lymphocyte ratio in Type 2 diabetic patients presenting with acute myocardial infarction. Qjm. 2012;105(11):1075–1082. doi:10.1093/qjmed/hcs123
32. Orhan AL, Şaylık F, Çiçek V, Akbulut T, Selçuk M, Çınar T. Evaluating the systemic immune-inflammation index for in-hospital and long-term mortality in elderly non-ST-elevation myocardial infarction patients. Aging Clin Exp Res. 2022;34(7):1687–1695. doi:10.1007/s40520-022-02103-1
33. Çetin M, Erdoğan T, Kırış T, et al. Predictive value of fibrinogen-to-albumin ratio in acute coronary syndrome. Herz. 2020;45(Suppl 1):145–151. doi:10.1007/s00059-019-4840-5
34. Odeberg J, Halling A, Ringborn M, et al. Markers of inflammation predicts long-term mortality in patients with acute coronary syndrome – a cohort study. BMC Cardiovasc Disord. 2025;25(1):190. doi:10.1186/s12872-025-04608-9
35. Sun T, Wei C, Wang D, et al. The small RNA mascRNA differentially regulates TLR-induced proinflammatory and antiviral responses. JCI Insight. 2021;6(21):e150833. doi:10.1172/jci.insight.150833
36. Prabhahar A, Batta A, Hatwal J, Kumar V, Ramachandran R, Batta A. Endothelial dysfunction in the kidney transplant population: current evidence and management strategies. World J Transplant. 2025;15(1):97458. doi:10.5500/wjt.v15.i1.97458
37. Horikoshi T, Nakamura T, Yoshizaki T, et al. Impact of persistent endothelial dysfunction in an infarct-related coronary artery on future major adverse cardiovascular event occurrence in STEMI survivors. Heart Vessels. 2021;36(4):472–482. doi:10.1007/s00380-020-01723-9
38. Tsalamandris S, Koliastasis L, Miliou A, et al. Endothelial function and pro-inflammatory cytokines as prognostic markers in acute coronary syndromes. Diagnostics. 2025;15(8):1033. doi:10.3390/diagnostics15081033
The Cambridge AS and A Level results for the June 2025 session have been officially released. Thousands of students across Pakistan and worldwide can now access their scores online. Cambridge International Education (CIE) announced the results earlier today, marking the conclusion of months of exams and preparation.
Students and teachers welcomed the announcement, with many schools already sharing their students’ achievements on social media. The release of the results is a key moment for learners aiming to secure university admissions or meet scholarship requirements.
Students can check their results by visiting the official Cambridge International Direct website. Follow these steps:
Students who face login issues should immediately contact their school’s exam officer for assistance.
After checking results, students can begin planning their next academic move. Those who did well may now apply to their preferred universities or programs. Others who want to improve their grades can register for the upcoming exam session. Additionally, Cambridge offers post-results services, including rechecking or re-marking exam papers.
With results now available, students are encouraged to act quickly on university application deadlines, as many institutions have limited slots for international qualifications.
Those awaiting their IGCSE and O Level results will have to wait a little longer, as CAIE is expected to release them next week.