Atypical presentation of Blastocystis-related dysentery in an HIV-infe

Introduction

Blastocystis hominis (B. hominis) is an intestinal protozoan parasite frequently identified in humans and a variety of animals.^1,2 It is estimated that one billion of the world population harbours Blastocystis sp. although the prevalence of B. hominis varies significantly depending on population demographics and geographical location, with higher rates reported in regions with inadequate sanitation.^3,4 Most infections are asymptomatic though occasionally it can cause gastrointestinal symptoms such as diarrhea, abdominal discomfort, and nausea.⁵

In individuals with compromised immune responses, such as those infected with the Human Immunodeficiency Virus (HIV), the risk of opportunistic infections is markedly increased.⁶ Despite not being categorized as a classical opportunistic infectious agent, B. hominis may behave opportunistically in patients with impaired immune systems due to increased potentials of colonization and symptom development.^6–8 Nevertheless, it is still unclear how exactly B. hominis infection affects the course of HIV and its treatment efficacies.

Conventional diagnostic methods for B. hominis using microscopic examination of stained stool samples often lack the sensitivity and specificity required for accurate detection. To this end, quantitative Polymerase Chain Reaction (qPCR) has emerged as a superior diagnostic technique, offering heightened accuracy in identifying parasitic infections, including those caused by B. hominis.⁹

This case report presents atypical presentation of Blastocystis-related dysentery in an HIV-infected patient, emphasizing the efficacy of qPCR for rapid and accurate confirmation of this parasite’s diagnosis. It also describes the response to combination therapies. This report highlights the critical role of advanced diagnostic techniques in the management of infections in immunocompromised individuals.

Case Description

A 20-year-old male was admitted to the outpatient clinic of Dr Saiful Anwar General Hospital in Malang, East Java, Indonesia, with a complaint of diarrhea about seven times per day which was experienced for the past four days. The diarrhea contained blood and mucus and was accompanied by stomach ache and nausea, with no vomiting. He also experienced fever for the past two weeks which co-existed with coughing and shortness of breath. There was a painless enlargement of the cervical gland on the left side due to cervical lymphadenopathy. The patient also suffered general malaise, which left him feeling of discomfort, illness, or fatigue. His appetite decreased, leading to significant weight loss. His skin was dry and itchy, and rashes appeared on his hands, feet, and almost all over the body surface.

As immunosuppression was suspected, the patient was subjected to HIV testing using three HIV rapid tests, including ViroCheck HIV ½ (RV-H25A, PT Indec Diagnostic, Indonesia), d3TEKS1 HIV 1/2 Antibody Rapid Test (PT Merah Putih Manufaktura, Indonesia), and Arkan Medical One Step Anti-HIV (1/2) and Syphilis Test Combo (PT Arkanindoplast Utama, Indonesia), all of which showed positive results. The CD4+ count was down to 78 cells/µL. These results ensuring that diagnosis HIV is established.

Further laboratory investigations, including routine blood tests, serology of Toxoplasma gondii (ECLIA, Elecsys Toxo IgG.07028008501.V4.en; Elecsys Toxo IgM.07028024501.V4.en), Cytomegalovirus/CMV (ECLIA, Elecsys CMV IgG.07027117500.V4.en; Elecsys CMV IgM.07027133501.V2.en) and HBsAg (ECLIA, Elecsys HBsAg II.08814848500.V5.en), failed to identify any common pathogens. Given the patient’s immunocompromised status, a more comprehensive parasitological examination was conducted. Stool samples were collected and prepared using direct smear, Giemsa, and Trichrome stain. Microscopic examination using direct smear identified amoeboid form of protozoa which showed prominent, extended pseudopodia of varying shape, while Giemsa and Trichrome stained samples showed cells containing large central bodies (vacuoles), with thin bands of cytoplasm around and the cells appearing to have “beaded rim”. The protozoa appearances were abundantly identified using microscopic examination, with more than five forms per high powered fields observed (Figure 1).

To further investigate the protozoan species, the DNA extraction was performed from his stool samples using (QIAamp DNA Mini Kit, Qiagen, Hilden, Germany). Following this, quantitative polymerase chain reaction (qPCR) was performed to target Giardia intestinalis, Entamoeba histolytica, Cryptosporidium spp., and Dientamoeba fragilis as previously published. An additional detection targeting Blastocystis hominis was performed using primers 5′- CCTGAGAGATGGCTACCACATCC −3′ and 5′- ATAGTCCCGCATTGTGATTTATTGT −3′, and a Quasar 705-based probe (5′- CGCGTAAATCACCCAATCCTGACACA −3′). The qPCR setup and cycles were performed according to the previously described protocol.¹⁰ The cycle threshold (Ct) was analyzed using CFX Maestro Software (Bio-Rad Laboratories, Inc., Singapore). The qPCR analysis revealed the presence of B. hominis DNA, with a Ct value of 40.29 (Figure 2).

Figure 2 The rt-PCR detection of Blastocystis hominis.

Both microscopy and molecular examinations confirmed the presence of B. hominis in the stool sample of the outpatient. The two positive methods for Blastocystis (microscopy and qPCR), showed a much stronger association. Thus, our results established a diagnosis of Blastocystosis for the patient. This result is significant considering the rarity of symptomatic B. hominis infection.

The patient was then treated with cotrimoxazole 960 mg twice a day and metronidazole 750 mg three times daily for ten days in addition to antiretroviral (ARV) treatment. The ARV prescribed for the patient using the combination of tenofovir 300 mg, lamivudine 300 mg, and dolutegravir 50 mg, per day. After the course of anti-parasitic treatment and ARV, the patient experienced a marked improvement of symptoms. Follow-up microscopic stool examination five days post-treatment showed negative result for B. hominis identification, and the patient reported a complete resolution of gastrointestinal symptoms after ten days.

Discussion

Blastocystis hominis is an intestinal protozoan parasite that is often overlooked due to its generally asymptomatic nature. Occasionally, it can cause gastrointestinal symptoms, particularly in immunocompromised patients^5,11 The case of a B. hominis infection in an HIV-infected patient, as described in this report, underscores several important considerations in the diagnosis and management of such infections.

This case is notable because of the atypical Blastocystis-related dysentery, as opposed to the commonly asymptomatic feature, found in an HIV-infected patient. Previous study on HIV patients have reported the presence of B. hominis in stool samples without clinical symptoms.¹² However, there were others who reported gastrointestinal symptoms related to B. hominis infection, which contribute in accelerating the progression of HIV/AIDS.^13,14

Although mostly asymptomatic, B. hominis infection may cause a range of clinical symptoms, including diarrhea, nausea, vomiting, stomach ache, flatulence, tenesmus, constipation, anorexia, weight loss, lethargy, fever, chills, dehydration, and insomnia. In this case, the patient experienced bloody and mucous diarrhea, with faecal leucocytosis, which was potentially caused by the amoeboid form of the parasite. It has been postulated that amoeboid forms of B. hominis contributed to Blastocystis pathology due to their capacity to adhere to intestinal epithelial cells.¹⁵ Other report demonstrated that vacuolar forms of Blastocystis sp. can reach the lamina propria, submucosa, and muscle layers in mice infected orally with this parasite.¹⁶

The other possibility of dysentery in this case was due to co-infection of Blastocystis with other pathogens, especially bacteria. Gastrointestinal symptoms, including abdominal discomfort, loss of appetite, and relative eosinophilia, were reportedly linked to Blastocystis sp. and pathogenic bacteria co-infection.¹⁷ In this case, the patient was screened for common intestinal parasites, however this does not rule out the possibility of bacteria or microsporidia infection. Previous study was revealed that B. hominis was positively associated with Campylobacter jejuni (C. jejuni)/Escherichia coli (E. coli), Giardia spp., Enterotoxigenic E. coli (ETEC), Enteropathogenic E. coli (EPEC), Shigella/Entero-invasive E. coli (EIEC), and Cryptosporidium spp. infection.¹⁸

Thus far, microscopic examination of stool samples is the gold standard and the most common method used in detecting intestinal parasites, particularly in Indonesia. This method is also beneficial for the identification of other findings including white blood cells, Charcot-Leyden crystals, etc.¹⁹ In addition, this conventional diagnostic method is useful to differentiate four distinct morphological forms of B. hominis, including vacuolar, granular, amoeboid, and cyst. However, microscopy is frequently reported to have low sensitivity and specificity, which may lead to potential misdiagnosis of B. hominis.⁴ In this case, we observed around 7–15 parasites per field of view. The amoeboid, vacuolar, and granular forms of the protozoa are clearly identifiable using conventional microscopy, but the parasite species was unable to be confirmed due to morphological similarity of the amoeboid form with that of Entamoeba.

The use of qPCR proved to be pivotal in accurately identifying B. hominis, demonstrating higher sensitivity and specificity of molecular techniques compared to traditional methods^5,16 The excellent performance of PCR compared to other diagnostic tools lies in its capability to detect low amount of parasite DNAs. Previous research has shown that PCR-based diagnostic approaches are more effective and sensitive for detecting B. hominis, with qPCR being the most sensitive. In this case, the qPCR identifies the parasite’s small subunit rRNA (SSU-rDNA) gene.⁴ In the future, further determination of Blastocystis subtypes in the sample using specific PCR primers or DNA sequencing methods could also provide important information on the molecular epidemiology and pathogenic potential of this parasite.

This case illustrates the need for advanced diagnostic techniques in clinical settings, especially for immunocompromised patients who may present atypical manifestations. Moreover, this case prompts further discussion about the role of routine qPCR screening for gastrointestinal pathogens in HIV-infected patients presenting with persistent gastrointestinal symptoms. While qPCR may not be universally available or cost-effective in all settings, its targeted use in specific cases could improve diagnostic accuracy and patient outcomes.

The successful treatment of the patient with cotrimoxazole and metronidazole, following accurate diagnosis using qPCR, led to the resolution of symptoms, elimination of parasites, and emphasizing the importance of accurate and timely diagnosis in guiding appropriate treatment.^20–22

Conclusion

In conclusion, Blastocystis hominis is a poorly understood intestinal protozoan, with continuously debatable properties of its pathogenicity. The occurrence of atypical Blastocystis-related dysentery in an HIV-infected patient and the successful use of qPCR for its diagnosis highlight critical aspects of managing parasitic infections in immunocompromised individuals. The integration of advanced molecular diagnostics into routine clinical practice can significantly enhance the detection and treatment of such infections, ultimately improving patient care leading to effective treatment and improved patient outcomes, particularly in immunocompromised individuals.

Informed Consent for Publication

Written consent for publication of case details was obtained from the patient. Institutional approval to publish the case details has been obtained from the Health Research Ethics Commission of the Faculty of Medicine Universitas Brawijaya (Approved on August 8, 2023, with the approval number 253/EC/KEPK/08/2023).

Acknowledgments

The authors would like to acknowledge to the patient for his willingness and Faculty of Medicine Universitas Brawijaya, Malang, Indonesia, for supporting this study.

Funding

This research received funding by a grant from the Faculty of Medicine, Universitas Brawijaya, Malang, Indonesia (grant number: 3173.2/2/UN10.F08/PN/2023).

Disclosure

The authors report no conflicts of interest in this work.

References

1. Naguib D, Gantois N, Desramaut J, et al. Molecular epidemiology and genetic diversity of the enteric protozoan parasite Blastocystis sp. in the Northern Egypt population. Pathogens. 2023;12(11):1359. doi:10.3390/pathogens12111359

2. Naguib D, Gantois N, Desramaut J, et al. Large-scale molecular epidemiological survey of blastocystis sp. among herbivores in Egypt and assessment of potential zoonotic risk. Microorganisms. 2024;12(7):1286. doi:10.3390/microorganisms12071286

3. Rudzińska M, Sikorska K. Epidemiology of Blastocystis Infection: a Review of Data from Poland in Relation to Other Reports. Pathogens. 2023;12(8):1050. doi:10.3390/pathogens12081050

4. Alamin U. Worldwide epidemiological study of Blastocystis subtypes in humans. A systematic review and meta-analysis. Thesis for MSc in infectious diseases. School of Biosciences University of Kent; 2023.

5. Stensvold CR, Clark CG. Current status of Blastocystis: a personal view. Parasitol Int. 2016;65(6 Pt B):763–771. doi:10.1016/j.parint.2016.05.015

6. Zhang SX, Wang JC, Li ZW, et al. Impact factors of Blastocystis hominis infection in persons living with human immunodeficiency virus: a large-scale, multi-center observational study from China. Infect Dis Poverty. 2023;12(1):82. doi:10.1186/s40249-023-01137-5

7. Chandramathi S, Suresh K, Sivanandam S, Kuppusamy UR. Stress exacerbates infectivity and pathogenicity of blastocystis hominis: In Vitro and in vivo evidences. PLoS One. 2014;9(5):e94567. doi:10.1371/journal.pone.0094567

8. Abdellatif MZM, Abdel-Hafeez EH, Belal US, et al. Detection of blastocystis species in immunocompromised patients (cancer, diabetes mellitus, and chronic renal diseases) by restriction fragment length polymorphism (RFLP). Beni-Suef Univ J Basic Appl Sci. 2025;14:42. doi:10.1186/s43088-025-00631-z

9. Roberts T, Barratt J, Harkness J, Ellis J, Stark D. Comparison of microscopy, culture, and conventional polymerase chain reaction for detection of Blastocystis sp. in clinical stool samples. Am J Trop Med Hyg. 2011;84(2):308–312. doi:10.4269/ajtmh.2011.10-0447

10. Kaisar MMM, Brienen EAT, Djuardi Y, et al. Improved diagnosis of Trichuris trichiura by using a bead-beating procedure on ethanol preserved stool samples prior to DNA isolation and the performance of multiplex real-time PCR for intestinal parasites. Parasitology. 2017;144(7):965–974. doi:10.1017/s0031182017000129

11. Surja SS, Kristin H, Hangestu A, et al. Common intestinal parasitic infections in an improved water access, sanitation, and hygiene profile setting in North Jakarta, Indonesia. Narra J. 2024;4(3):e1264. doi:10.52225/narra.v4i3.1264

12. Albrecht H, Stellbrink HJ, Koperski K, Greten H. Blastocystis hominis in human immunodeficiency virus-related diarrhea. Scand J Gastroenterol. 1995;30(9):909–914. doi:10.3109/00365529509101600

13. Ning CQ, Hu ZH, Chen JH, Ai L, Tian LG. Epidemiology of Blastocystis infection from 1990 to 2019 in China. Infect Dis Poverty. 2020;9(1):168. doi:10.1186/s40249-020-00779-z

14. Mayer KH, Karp CL, Auwaerter PG, Mayer KH. Coinfection with HIV and tropical infectious diseases. II. Helminthic, fungal, bacterial, and viral pathogens. Clin Infect Dis. 2007;45(9):1214–1220. doi:10.1086/522180

15. Vielma JR. Blastocystosis: epidemiological, clinical, pathogenic, diagnostic, and therapeutic aspects // Blastocistosis: aspectos epidemiológicos, clínicos, patogénicos, diagnósticos y terapéuticos. Investigación Clínica. 2020;60(1):53–78. doi:10.22209/IC.v60n1a06

16. Zhou YL, Zhao N, Yang Y, et al. Molecular identification and subtype analysis of Blastocystis in captive asiatic black bears (Ursus thibetanus) in China’s Heilongjiang and Fujian provinces. Front Cell Infect Microbiol. 2022;12:993312. doi:10.3389/fcimb.2022.993312

17. Matovelle C, Tejedor MT, Monteagudo LV, Beltrán A, Quílez J. Prevalence and Associated Factors of Blastocystis sp. Infection in Patients with Gastrointestinal Symptoms in Spain: A Case-Control Study. Trop Med Infect Dis. 2022;7(9):226. doi:10.3390/tropicalmed7090226

18. Zaman Wahid B, Haque MA, Gazi MA, et al. Site-specific incidence rate of Blastocystis hominis and its association with childhood malnutrition: findings from a multi-country birth cohort study. Am J Trop Med Hyg. 2023;108(5):887–894. doi:10.4269/ajtmh.22-0662

19. Stubbe C, Powell L. Parasitology Stool Diagnostic From Basics to Blastocystis. Asheville, NC: Genova Diagnostics 2019;1–61. Available from: https://www.gdx.net/files/livegdx/2019/parasitology-stool-diagnostics-from-basics-to-blastocystis-july-livegdx.pdf.

20. CDC. Clinical care of blastocystosis. 2024. Available from: https://www.cdc.gov/blastocystis/hcp/clinical-care/index.html. Accessed July 17, 2025.

21. Rajamanikam A, Hooi HS, Kudva M, Samudi C, Kumar S. Resistance towards metronidazole in Blastocystis sp.: a pathogenic consequence. PLoS One. 2019;14(2):e0212542. doi:10.1371/journal.pone.0212542

22. Roberts T, Bush S, Ellis J, Harkness J, Stark D. In vitro antimicrobial susceptibility patterns of Blastocystis. Antimicrob Agents Chemother. 2015;59(8):4417–4423. doi:10.1128/AAC.04832-14