Introduction
Diabetes is a set of metabolic disorders characterized by persistently high blood glucose levels, which can cause damage to various parts of the body and lead to dysfunction.1
Diabetes mellitus type 2 (T2DM) is common in the Arab population and around the world. In Saudi Arabia, T2DM ranks second in the Middle East and seventh globally. The number of cases worldwide is expected to rise to more than 500 million by 2030.2 Elevated blood glucose and insulin resistance are the main features of the disease. In addition, as the disease progresses, several comorbidities develop, including retinopathy, nephropathy, hypertension, cardiovascular disease, neuropathy, and others. The disease can be avoided by improving lifestyle choices such as balanced diet, physical activity, and quitting smoking.3,4
A complex interaction between genetic and environmental factors is thought to be the cause of T2DM.5 Endothelin is a group of endogenous peptides synthesized in various tissues and acting as regulators of growth, vascular tone, and hormone synthesis. Endothelin is released mainly from endothelial cells. Endothelin has many isoforms, the most common of which is ET-1.6,7 ET-1 acts by interacting with both type A and type B receptors, leading to cell growth and vasoconstriction.8,9 ET-1 plays a role in the pathophysiology of cardiovascular diseases and renal diseases. For example, endothelial dysfunction leads to increased in ET-1 production, resulting in atherogenesis, vascular hypertrophy, and glomerulosclerosis.10–12 Patients with T2DM have been found to have increased levels of ET-1 in their plasma.13,14 Treatment of cultured human cells with glucose has been shown to increase the expression of ET-1 via epigenetic mechanisms.15 In addition, variations in the END1 gene have been shown to modulate the development of some morbidities associated with T2DM.8,16 The rs5370G>T polymorphism of the EDN1 gene is a mis-sense mutation that causes the replacement of lysine by asparagine in ET-1. This polymorphism has been shown to impact ET-1 in the circulation.17,18 In addition, the rs5370 polymorphism has been associated with some T2DM complications.19 In the present study, the associations between ET-1 and END1 rs5370 polymorphism with susceptibility to T2DM and its associated complications were examined among patients from Saudi Arabia.
Materials and Methods
Study Subjects
The study was case-control in design and included 190 subjects with T2DM (case group) and 120 healthy subjects (control group). Patients were recruited from various hospitals in Madinah, SA during the period since 07 January 2024 to 05 January 2025. Patients were diagnosed with T2DM based on World Health Organization (WHO) diagnostic criteria, which include HbA1C ≥ 6.5%, and fasting blood glucose (FBG) ≥7.0 mmol/L. Patients with acute illnesses, cancer, pregnant women, and liver diseases were excluded from cases and controls. Nephropathy diagnosis based on glomerular filtration rate (GFR) less than 60 mL/min, and urine albumin-to-creatinine ratio (UACR) ≥ 30 mg/g,20 any borderline or type 1 diabetes were excluded. Retinopathy diagnosed by fundus findings (microaneurysms, hemorrhages, neovascularization) with retinal imaging.21 Cardiovascular disease diagnosed based to ADA outlines includes clinical and lab markers.22 Neuropathy diagnosed based to American academy of neurology includes clinical signs and nerve conduction study.23
The study protocol was permitted by the “Research Ethics Committee” of Taibah University (Approval No. CLS 202097). The committee operates in accordance with the “1964 Declaration of Helsinki and its amendments”. Written informed consent was obtained from study participants prior to participation.
Biochemical Parameters
Blood samples were collected from participants in oxalate tubes for blood glucose testing and in EDTA tubes for other measurements. ET-1 levels were measured using an ELISA assay developed by Thermo-Fisher company (USA).24 Glucose, lipids, urea, creatinine, and albumin levels were measured enzymatically with Dimension® EXL™ 200 Integrated Chemistry analyzer (Siemens, Erlangen, Germany). Albumin to creatinine ratio was measured as previously described.25 HbA1c was determined using a D-10™ Hemoglobin Analyzer from Bio-Rad (Nyocard, USA).
DNA Extraction
Blood DNA was extracted using a kit obtained from Fermentas company (USA). The quality/quantity of extracted DNA were verified using spectrophotometric methods by measuring absorbance at a wavelength 260/280 nm. DNA was kept at −30°C until further applications.
Genotyping of EDN1 rs5370 Polymorphism
The “polymerase chain reaction amplification-refractory mutation system (PCR-ARMS)” was used to genotype EDN1 rs5370 polymorphism as previously described.26 PCR amplification was performed using a thermocycler obtained from BioRad (model MT100tm, USA). The used primers were: Reverse common primer 5´AGTCAGGAACCAGCAGAGGA3´, and forward allele specific primers: G allele- 5´ATCCGAAGCTGAAAGGCAAG3´, and T allele-5´ATCCGAAGCTGAAAGGCAAT3´. PCR reaction was performed in 0.5mL PCR tube in a total reaction volume of 25µL (2X master mix obtained from ThermoFisher Scientific, 100ng of genomic DNA and 50 pmol of each primer. Two reactions for each sample were performed to distinguish amplification from the two forward primers. Amplification conditions were denaturation (5min/95°C), 35 cycles (95°C/60s, 58°C/45s and 72°C/45s), and a final extension (72°C/5min). Gel electrophoresis was performed on 2.5% agarose gel, and DNA fragments were visualized under UV light and EtBr. The amplified PCR fragment from each forward primer was 179bp. Amplification from both allele specific primers indicates the heterozygous genotype (GT). Amplification from a single allele specific primer indicates the homozygous genotype (GG or TT depending on the forward primer used).
Statistical Analysis
Data were analyzed using SPSS version 23. For comparison, the unpaired Student’s t-test, ANOVA, Fisher exact test, or Chi-square test were used as appropriate. A P<0.05 indicates a statistically significant difference.
Results
Baseline Characteristics of Participants
Table 1 shows the demographic and clinical data of T2DM patients and the control group. No statistical differences were observed in gender, age, and smoking status between the two groups (P>0.05). On the other hand, there were differences between patients and controls in fasting blood glucose, HbA1c, lipid profile, urea albumin to creatinine ratio, creatinine, nephropathy, retinopathy, neuropathy, cardiovascular disease, and hypertension (P<0.05). Plasma ET-1 levels in the studied groups. ET-1 was significantly higher in patients than controls (p<0.01).
|
Table 1 Demographic and Clinical Characteristics of Participants
|
Distribution of END1 Gene rs5370 Polymorphism
Table 2 shows the distribution of genotypes and alleles of the rs5370 EDN1 polymorphism among T2DM and controls. The rs5370 EDN1 polymorphism is in Hardy-Weinberg equilibrium in the study sample (P=0.113). The frequency of the G allele was 78.3% in the control group and 74.7% in the T2DM group (P=0.306). The frequencies of the GG, GT, and TT genotypes were 60.8%, 35%, and 4.2% in the control group and 53.7%, 42.1%, and 4.2% in the T2DM group, respectively (P=0.447). Thus, the rs5370 polymorphism was not associated with susceptibility to T2DM in the studied population (P>0.05).
 |
Table 2 Distribution of ET-1 (EDN1) Gene rs5370 Polymorphisms Genotypes and Alleles in Patients with T2DM Diabetic and Controls
|
Distribution of END1 Gene rs5370 Polymorphism with Different Aspects
To further examine the contribution of the EDN1 gene rs5370 polymorphism to T2DM pathology, Table 3 shows the different clinical measures across rs5370 genotypes in T2DM group. The results showed a significantly high frequency of nephropathy among patients with TT genotype compared to patients with the GG genotype (P=0.033, OR [95% CI]: 8.14 [1.60–41.32]). In addition, BMI, total cholesterol, fasting glucose, and ET-1 were significantly higher in patients with TT genotype compared to other genotypes (P<0.05). With respect to the relationship between cardiovascular disease and the rs5370 polymorphism, a marginal association was observed (P=0.060; OR [95% CI]: 1.75 [0.80–3.81]). However, no association was observed between rs5370 and T2DM complications including neuropathy OR [95% CI]: 0.82 [0.25–2.73]), hypertension (OR [95% CI]: 1.64 [0.69–3.89]), and retinopathy (OR [95% CI]: 1.75 [0.70–4.39]). Moreover, rs5370 did not affect biochemical parameters including HbA1c, LDL, and HDL among T2DM (P>0.05). Thus, the TT genotype seems to impact several clinical parameters in T2DM.
 |
Table 3 Distribution of ET-1 (EDN1) Gene rs5370 Polymorphisms Genotypes and Alleles in Patients with T2DM with Different Clinical and Anthropometric Aspects
|
Discussion
T2DM predisposes individuals to numerous complications, including hypertension, neuropathy, cardiovascular disease, nephropathy, and retinopathy. T2DM is caused by both genetic and environmental factors. Hundreds of genetic variations have been shown to modulate the risk of developing T2DM.27
The rs5370 variant of the EDN1 gene causes a Lys/Asn amino acid substitution, which may impact ET-1 maturation in endothelial cells.28 The clinical significance of rs5370 is well documented.29–31 In the current study, we investigated the possible association between the rs5370 and T2DM complications.
The study showed no association between rs5370 EDN1gene polymorphism and T2DM. This finding is consistent with previous studies conducted in Caucasian, Chinese and Jordanian populations.19,25,32 Thus, it appears that the rs5370 polymorphism does not affect the risk of T2DM.
The study also examined the relationship between T2DM complications and the rs5370 polymorphism. The rs5370 was found to be associated with nephropathy and marginally associated with cardiovascular disease in T2DM. The rs5370 TT genotype was found to increase the risk of these complications in T2DM. A meta-analysis reported that the rs5370 increased the risk of ischemic stroke.29 In a study conducted in Iran, rs5370 was found to be associated with coronary atherosclerosis.33 In addition, rs5370 was found to be associated with the severity of coronary artery disease in the Russian population.34 In contrast, no association between rs5370 and nephropathy was observed among Caucasians with T2DM.25,35 The current study showed no association between the rs5370 and blood pressure, neuropathy, and retinopathies in T2DM patients. Similar findings have been reported in studies from Iran, Jordan, and China.32,33,36 However, a previous study reported an association between rs5370 and retinopathy in T2DM patients.19 Moreover, the rs5370 polymorphism has been shown to impact blood pressure in individuals with obesity.28,37–39 Thus, the association between rs5370 and complications of T2DM seems to be complex and modulated by the genetic background of the population.
In the present study, ET-1 levels were found to be elevated in T2DM, consistent with previous studies.40–42 Moreover, in a recent in vitro study in Saudi Arabia, there was a markedly elevated in EDN1 gene expression as a result of exposure to high glucose in cell culture.43 ET-1 is a vasoconstrictor agent and involved in fibrosis and inflammation responses. ET-1 has been found to impact renal function through modulation of vascular/mesangial tone; ions excretion; and cell division and matrix remodeling.8,44
Among the limitations of the study is the low sample size, specially number of individuals with T2DM complications, which might lower the study power analysis. In addition, data regarding covariates that might impact observed associations like duration of diabetes, medication use, or family history were not collected. Therefore, we recommend a larger study to confirm the study findings.
Conclusions
Circulatory ET-1 levels are elevated in patients with T2DM. The EDN1 rs5370 polymorphism might impact the risk of nephropathy in T2DM. Further studies with a larger sample are needed to confirm the present findings.
Ethics
Ethical clearance for this research was obtained from the Research Ethics Committee at the College of Applied Medical Sciences, Taibah University, Madinah, Saudi Arabia (Approval No. CLS 202097), following the ethical guidelines established in the 1964 Declaration of Helsinki and its later revisions.
Acknowledgments
The authors express gratitude to the college of Applied Sciences at Taibah University for their support.
Author Contributions
All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
Funding
This research received no external funding.
Disclosure
The authors report no conflicts of interest in this work.
References
1. Organization WH. Classification of diabetes mellitus. In: Classification of Diabetes Mellitus. 2019.
2. Laakso M, Kuusisto J. Insulin resistance and hyperglycaemia in cardiovascular disease development. Nat Rev Endocrinol. 2014;10(5):293–302. doi:10.1038/nrendo.2014.29
3. Magliano DJ, Boyko EJ, Atlas ID. What is diabetes? In: IDF DIABETES ATLAS [Internet].
4. AlJabr Q, Alalawi M, Aldhneen B, et al. Association of BMI and incidence of type 2 diabetes in Saudi population. Health Sci Rep. 2024;7(3):e1951. doi:10.1002/hsr2.1951
5. Mambiya M, Shang M, Wang Y, et al. The play of genes and non-genetic factors on type 2 diabetes. Front Public Health. 2019;7:349. doi:10.3389/fpubh.2019.00349
6. Yanagisawa M, Kurihara H, Kimura S, et al. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332(6163):411–415. doi:10.1038/332411a0
7. Rubanyi G, Botelho LP. Endothelins 1. FASEB J. 1991;5(12):2713–2720. doi:10.1096/fasebj.5.12.1916094
8. Zanatta CM, Crispim D, Sortica DA, et al. Endothelin-1 gene polymorphisms and diabetic kidney disease in patients with type 2 diabetes mellitus. Diabetol Metab Syndr. 2015;7(1):1–8. doi:10.1186/s13098-015-0093-5
9. Levey AS, Coresh J, Balk E, et al. National Kidney Foundation practice guidelines for chronic kidney disease: evaluation, classification, and stratification. Ann Internal Med. 2003;139(2):137–147. doi:10.7326/0003-4819-139-2-200307150-00013
10. Ohta K, Hirata Y, Shichiri M, et al. Urinary excretion of endothelin-1 in normal subjects and patients with renal disease. Kidney Int. 1991;39(2):307–311. doi:10.1038/ki.1991.38
11. Benigni A, Perico N, Remuzzi G. Research on renal endothelin in proteinuric nephropathies dictates novel strategies to prevent progression. Curr Opin Nephrol Hypertens. 2001;10(1):1–6. doi:10.1097/00041552-200101000-00001
12. Hocher B, Schwarz A, Reinbacher D, et al. Effects of endothelin receptor antagonists on the progression of diabetic nephropathy. Nephron. 2001;87(2):161–169. doi:10.1159/000045906
13. Seligman B, Biolo A, Polanczyk CA, Gross JL, Clausell N. Increased plasma levels of endothelin 1 and von Willebrand factor in patients with type 2 diabetes and dyslipidemia. Diabetes Care. 2000;23(9):1395–1400. doi:10.2337/diacare.23.9.1395
14. Schneider JG, Tilly N, Hierl T, et al. Elevated plasma endothelin-1 levels in diabetes mellitus. Am J Hypertens. 2002;15(11):967–972. doi:10.1016/S0895-7061(02)03060-1
15. Biswas S, Feng B, Thomas A, et al. Endothelin-1 regulation is entangled in a complex web of epigenetic mechanisms in diabetes. Physiol Res. 2018;67:S115.
16. Tziastoudi M, Stefanidis I, Zintzaras E. The genetic map of diabetic nephropathy: evidence from a systematic review and meta-analysis of genetic association studies. Clin Kidney J. 2020;13(5):768–781. doi:10.1093/ckj/sfaa077
17. Aggarwal PK, Jain V, Srinivasan R, Jha V. Maternal EDN1 G5665T polymorphism influences circulating endothelin-1 levels and plays a role in determination of preeclampsia phenotype. J Hypertension. 2009;27(10):2044–2050. doi:10.1097/HJH.0b013e32832f7f3f
18. Barden AE, Herbison CE, Beilin LJ, Michael CA, Walters BN, Van Bockxmeer FM. Association between the endothelin-1 gene Lys198Asn polymorphism blood pressure and plasma endothelin-1 levels in normal and pre-eclamptic pregnancy. J Hypertension. 2001;19(10):1775–1782. doi:10.1097/00004872-200110000-00011
19. Li H, Louey JW, Choy KW, et al. EDN1 Lys198Asn is associated with diabetic retinopathy in type 2 diabetes. Mol Vision. 2008;14:1698.
20. Cao H, Song L, Wang X, Guan H. Non-linear relationship between urinary creatinine and diabetic kidney disease: implications for clinical practice. BMC Nephrol. 2025;26(1):40. doi:10.1186/s12882-025-03971-1
21. Flaxel CJ, Adelman RA, Bailey ST, et al. Diabetic retinopathy preferred practice pattern®. Ophthalmology. 2020;127(1):P66–P145. doi:10.1016/j.ophtha.2019.09.025
22. Cardiovascular disease and risk management: standards of care in diabetes—2025. Diabetes Care. 2025;48(Supplement_1):S207–S238. doi:10.2337/dc25-S010
23. Elafros MA, Callaghan BC. Diabetic neuropathies. Continuum. 2023;29(5):1401–1417. doi:10.1212/CON.0000000000001291
24. Liang L-L, Chen L, Zhou M-Y, et al. Genetic susceptibility of five tagSNPs in the endothelin-1 (EDN1) gene to coronary artery disease in a Chinese Han population. Biosci Rep. 2018;38(5):BSR20171320. doi:10.1042/BSR20171320
25. Šeruga M, Kariž S, Makuc J, et al. Endothelin-1 gene polymorphisms rs5370, rs1476046, and rs3087459 are not associated with diabetic nephropathy in Caucasians with type 2 diabetes mellitus. Folia Medica. 2017;59(3):261–269. doi:10.1515/folmed-2017-0033
26. Rizk H, Hammad A, El-Said A, Wahba Y. Endothelin-1 rs5370 gene polymorphism in primary nephrotic syndrome: a case-control study. Anales de Pediatría. 2021;95(6):406–412. doi:10.1016/j.anpede.2020.12.001
27. Cole JB, Florez JC. Genetics of diabetes mellitus and diabetes complications. Nat Rev Nephrol. 2020;16(7):377–390. doi:10.1038/s41581-020-0278-5
28. Tiret L, Poirier O, Hallet V, et al. The Lys198Asn polymorphism in the endothelin-1 gene is associated with blood pressure in overweight people. Hypertension. 1999;33(5):1169–1174. doi:10.1161/01.HYP.33.5.1169
29. Nepal G, Ojha R, Dulal HP, Yadav BK. Association between Lys198Asn polymorphism of endothelin‐1 gene and ischemic stroke: a meta‐analysis. Brain Behav. 2019;9(10):e01424. doi:10.1002/brb3.1424
30. Ahmed M, Rghigh A. Polymorphism in endothelin-1 gene: an overview. Current Clin Pharmacol. 2016;11(3):191–210. doi:10.2174/1574884711666160701000900
31. Kitsios G, Zintzaras E. Genetic variation associated with ischemic heart failure: a HuGE review and meta-analysis. Am J Epidemiol. 2007;166(6):619–633. doi:10.1093/aje/kwm129
32. Maslat AO, Al-Mahmood OM, Al Khawaja NM, Al-Shdefat R. Association of genetic polymorphisms of EDN1 gene and endothelin-1 level in patients with type 2 diabetes mellitus in the Jordanian population. Heliyon. 2024;10(1):e23676. doi:10.1016/j.heliyon.2023.e23676
33. Ebrahimi N, Asadikaram G, Mohammadi A, Jahani Y, Moridi M, Masoumi M. The association of endothelin-1 gene polymorphism and its plasma levels with hypertension and coronary atherosclerosis. Arch Med Sci. 2019;17(3):613. doi:10.5114/aoms.2019.86770
34. Ponasenko A, Sinitskaya A, Sinitsky M, Khutornaya M, Barbarash O. The role of polymorphism in the endothelial homeostasis and vitamin D metabolism genes in the severity of coronary artery disease. Biomedicines. 2023;11(9):2382. doi:10.3390/biomedicines11092382
35. Choręziak-Michalak A, Szpecht D, Woźniak T, et al. Association of endothelial nitric oxide synthase (NOS3) rs2070744 variant with advanced retinopathy of prematurity: a case–control study and meta-analysis. Sci Rep. 2025;15(1):329. doi:10.1038/s41598-024-83305-7
36. Chen T, Ma J, Shan G, Zhong Y. The polymorphisms of ATOH 7, ET-1 and ACE in non-arteritic anterior ischemic optic neuropathy. Exp Eye Res. 2018;174:147–151. doi:10.1016/j.exer.2018.05.021
37. Barath A, Endreffy E, Bereczki C, et al. Endothelin-1 gene and endothelial nitric oxide synthase gene polymorphisms in adolescents with juvenile and obesity-associated hypertension. Acta Physiologica Hungarica. 2007;94(1–2):49–66. doi:10.1556/APhysiol.94.2007.1-2.6
38. Treiber FA, Barbeau P, Harshfield G, et al. Endothelin-1 gene Lys198Asn polymorphism and blood pressure reactivity. Hypertension. 2003;42(4):494–499. doi:10.1161/01.HYP.0000091266.41333.15
39. Asai T, Ohkubo T, Katsuya T, et al. Endothelin-1 gene variant associates with blood pressure in obese Japanese subjects: the Ohasama study. Hypertension. 2001;38(6):1321–1324. doi:10.1161/hy1101.095333
40. Sadeghi MB, Nakhaee A, Saravani R, Sargazi S. Significant association of LXRβ (NR1H2) polymorphisms (rs28514894, rs2303044) with type 2 diabetes mellitus and laboratory characteristics. J Diabetes Metab Disord. 2021;20(1):261–270. doi:10.1007/s40200-021-00740-3
41. Sargazi S, Heidari Nia M, Sargazi FM, Sheervalilou R, Saravani R, Mirinejad S. SNPs in the 3′-untranslated region of SLC30A8 confer risk of type 2 diabetes mellitus in a south-east Iranian population: evidences from case-control and bioinformatics studies. J Diabetes Metab Disord. 2020;19(2):979–988. doi:10.1007/s40200-020-00590-5
42. Naruse M, Nakamura N, Naruse K, et al. Plasma immunoreactive endothelin levels are increased in hemodialysis patients with hypertension following erythropoietin therapy. Hypertens Res. 1992;15(1):11–16. doi:10.1291/hypres.15.11
43. Binjawhar DN, Alhazmi AT, Bin Jawhar WN, MohammedSaeed W, Safi SZ. Hyperglycemia-induced oxidative stress and epigenetic regulation of ET-1 gene in endothelial cells. Front Genetics. 2023;14:1167773. doi:10.3389/fgene.2023.1167773
44. Mattia GD, Cassone-Faldetta M, Bellini C, et al. Role of plasma and urinary endothelin-1 in early diabetic and hypertensive nephropathy. Am J Hypertens. 1998;11(8):983–988. doi:10.1016/S0895-7061(98)00094-6