TFS: Conception of project, data analysis, interpretation of results, writing the manuscript; YHAW: Conception of project, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; AO: Conception of project, acquired data, interpretation of results, revised the manuscript, approved the final version; MA: Conception of project, data analysis, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; WM: Conception of project, revised the manuscript, approved the final version; MGB: Conception of project, revised the manuscript, approved the final version, supervision; RAB: Conception of project, revised the manuscript, approved the final version, supervision; JWW: Conception of project, revised the manuscript, approved the final version, supervision; MDC: Conception of project, revised the manuscript, approved the final version, supervision. All coauthors meet the following criteria: 1. Conceived and/or designed the work that led to the submission, acquired data, and/or played an important role in interpreting the results. 2. Drafted or revised the manuscript. 3. Approved the final version. 4. Agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Category: 3. Business
-

Dilated cardiomyopathy-associated RNA-binding motif protein 20 regulates long pre-mRNAs in neurons
The CLIP experiments were performed according to the seCLIP protocol (Van Nostrand et al., 2017a) with some minor modifications (Traunmüller et al., 2023). Olfactory bulbs from seven mice were pooled for each biological replicate, and for heart tissue, one heart was used per biological replicate. Samples were flash-frozen and ground on dry ice first in a metal grinder and a porcelain mortar. The frozen powder was transferred into a plastic Petri dish and distributed in a thin layer. The samples were UV-cross-linked three times at 400 mJ/cm2 on dry ice with a UV-cross-linker (Cleaver Scientific). The powder was mixed and redistributed on the Petri dish before each UV exposure. After cross-linking, the powder was collected in 3.5 ml (olfactory bulbs) or 5.5 ml (heart) in lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, complete protease inhibitors, Roche) and 4 U/ml Turbo-DNase (Thermo Fisher). Samples were further processed as described in detail below.
For the clip samples preparation, the lysate was transferred into a glass homogenizer and homogenized by 30 strokes on ice. 1 ml aliquots of homogenized tissue were transferred to 2 ml tubes, 10 µl of RNaseI (Thermo Fisher) diluted in PBS (1:5–1:40) were added to each tube. Samples were incubated at 37°C with shaking for 5 min at 1200× rpm and then put on ice. 10 µl RNasin RNase inhibitor (40 U/µl, Promega) was added to each tube. Samples were mixed and centrifuged at 16,000 × g for 15 min at 4°C. The supernatants were transferred to a new tube, and 60 µl from each sample was taken and further processed for sized-matched INPUT (SMIn). 10 µl HA-magnetic beads (Pierce) was added to each sample and incubated at 4°C for 4 hr in a rotating shaker. Following incubation, the beads were washed 2× with a high salt wash buffer (50 mM Tris-HCl pH 7.5, 1 M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate), 2× with the lysis buffer, 2× with low salt wash buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.2% Tween-20) and 1× with PNK buffer (70 mM Tris-HCl pH 6.5, 10 mM MgCl2). Beads were resuspended in 100 µl PNK mix (70 mM Tris-HCl pH 6.5, 10 mM MgCl2, 1 mM DTT, 100 U RNasin, 1 U TurboDNase, 25 U Polynucleotide-Kinase [NEB]) and incubated at 37°C for 20 min on a shaking termomixer (1200× rpm). Upon RNA dephosphorylation, the beads were washed (2× high salt, 2× lysis, and 2× low salt buffers as before) and additionally with 1× Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2). Beads were then resuspended in 50 µl ligase mix (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 3% DMSO, 15% PEG8000, 30 U RNasin, 75 U T4 RNA-ligase [NEB]). 10 µl of the beads/ligase mix was transferred to a new tube, and 1 µl of pCp-Biotin (Jena Bioscience) was added to validate IP of the RNA-protein complexes by western blot. 4 µl of the RNA-adaptor mix containing 40 µM of each InvRiL19 & InvRand3Tr3 (IDT) was added to the remaining of the samples (40 µl). Samples were incubated at room temperature for 2 hr for adaptor ligation. Samples were washed 2× with high salt, 2× with lysis, and 1× with low salt buffers. Finally, beads were resuspended in 1× LDS sample buffer (Thermo Fisher) supplemented with 10 µM DTT and incubated for 10 min at 65°C, shaking on a thermomixer at 1200× rpm. Eluates or inputs were loaded on 4–12% Bis-Tris, 1.5 mm gel (Thermo Fisher) and separated at 130 V for ~1.5 hr. Proteins were transferred overnight at 30 V to a nitrocellulose membrane (Amersham). The membranes were placed in a 15 cm Petri dish on ice, and an area between 55 and 145 kDa was cut out into small pieces and transferred into a 2 ml tube.
RNA extraction, reverse transcription using InvAR17 primer, cDNA clean-up using silane beads (Thermo Fisher), second adaptor ligation (InvRand3Tr3), and cDNA purification steps were performed as previously described (Van Nostrand et al., 2016). The sequencing libraries were amplified using Q5-DNA polymerase (NEB) and i50X/i70X Illumina indexing primers (IDT). Final libraries were amplified with 14 cycles. Libraries were purified and concentrated with ProNEX size-selective purification system (Promega) using sample/beads ratio of 1/2.4. Samples were loaded on a 2% agarose gel, and the area corresponding to the size between 175 and 350 bp was cut out. The amplified and purified libraries were then extracted from the gel using a gel extraction kit (Machery&Nagel) and eluted with 16 µl.
The concentrations and the size distributions of the libraries were determined on the Fragment Analyzer system (Agilent). 75 bp single-end sequencing was performed on the NextSeq500 platform using Mid Output Kit v2.5 (75 cycles).
Adaptor and primer sequences used in this study:
Name Sequence InvRi L19 /5Phos/rArGrArUrCrGrGrArArGrArGrCrArCrA rCrGrUrC/3SpC3/ InvRand3Tr3 /5Phos/NNNNNNNNNNAGATCGGAAGA GCGTCGTGT/3SpC3/ InvA R17 CAGACGTGTGCTCTTCCGA i501 AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i502 AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATC*T i503 AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i504 AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGATC*T i701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i702 CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i703 CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i704 CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T X* = Phosphorthioated base
seCLIP data processing was performed as described (Van Nostrand et al., 2016; Van Nostrand et al., 2017b; Van Nostrand et al., 2020). In brief, raw reads were processed to obtain unique CLIP tags mapped to mm10 using Clipper (https://github.com/YeoLab/clipper ; Lovci et al., 2025; https://github.com/YeoLab/eclip ; Yee and Domissy, 2022). Reads from replicates 1 and 2 from the olfactory bulb were concatenated. Peak normalization was performed by processing the SMInput samples using the same peak calling pipeline. Irreproducible discovery rate (IDR) analysis was performed to identify reproducible peaks across biological replicates (Li et al., 2011). IDR (https://github.com/nboley/idr; Boley, 2017) was used to rank seCLIP peaks by the fold change over the size-matched input. Clip peaks were called based on IDR<0.05. We observed some short highly represented sequences that were not specific to RBM20 seCLIP isolations, which were excluded based on peak shape and width (<30 bp) using StoatyDive (Heyl and Backofen, 2021).
For motif discovery, cross-link-induced truncation sites (CITS) were called using the CTK pipeline (Shah et al., 2017). Briefly, unique tags from replicates were combined, and CITS were called by requiring FDR<0.001. Sequences from –10 bp to +10 bp from called CITS were used as input sequences for DREME software (Bailey et al., 2009; Bailey et al., 2015; Nystrom and McKay, 2021). As a control, sequences of the same length located 500 bp upstream of the CITS site (–510 to –490 bases) were used. Enrichment of the UCUU motif at the CITS sites was calculated.
Continue Reading
-

Google scraps AI Overviews for certain medical queries: Find out why
Google scraps AI Overviews for certain medical queries: Find out why Following an investigation by a prominent news outlet that found misleading information in Google’s AI Overviews for health-related searches, the search giant has removed the AI-assisted summaries for health-specific queries.
The investigation found that asking “what is the normal range for liver blood tests” yielded results that failed to consider crucial factors such as age, sex, ethnicity, and nationality. It is suspected that this omission might lead users to misinterpret their health results.
The Guardian reported that AI Overviews have been eliminated for queries like “what is the normal range for liver blood tests” and “what is the normal range for liver function tests.” However, variations of the same queries, such as “lft reference range,” are still offering AI summaries.
As reported by TechCrunch, there were no AI Overviews upon testing these queries shortly after the Guardian’s report, although Google still provided an option to ask in AI Mode.
The interesting twist is: the top result often directed users to the Guardian’s article discussing the removal.
The company does not comment on specific removals but is committed to making meaningful improvements, a Google spokesperson was quoted as saying.
They noted that Google’s internal health experts reviewed the queries in question and found that the information was not necessarily inaccurate and was supported by reputable sources.
Vanessa Hebditch, the director of communications and policy at the British Liver Trust, cherished the removal but expressed concern that this action addresses only a single issue rather than AI Overviews’ wider implications in health-related searches.
Continue Reading
-
S&P Global Completes Sale of EDM and thinkFolio Businesses
NEW YORK, Jan. 12, 2026 /PRNewswire/ — S&P Global (NYSE: SPGI) today announced it has completed the sale of its EDM and thinkFolio businesses to STG, a private equity firm focused on building and scaling market-leading software, data and analytics companies.

The transaction, which was announced in October 2025, does not have material impact to S&P Global financials. Financial terms were not disclosed. Local closings in certain jurisdictions are expected to occur over the following few months.
Barclays acted as financial advisor and Skadden, Arps, Slate, Meagher & Flom LLP acted as legal advisor to S&P Global on the transaction.
Media Contacts:
Orla O’Brien
S&P Global
+1 857 407 8559
orla.obrien@spglobal.comErina Aoyama
S&P Global Market Intelligence
+1 917 755 7943
erina.aoyama@spglobal.comAbout S&P Global:
S&P Global (NYSE: SPGI) provides essential intelligence. We enable governments, businesses and individuals with the right data, expertise, and connected technology so that they can make decisions with conviction. From helping our customers assess new investments to guiding them through sustainability and energy transition across supply chains, we unlock new opportunities, solve challenges, and accelerate progress for the world.
We are widely sought after by many of the world’s leading organizations to provide credit ratings, benchmarks, analytics and workflow solutions in the global capital, commodity, and automotive markets. With every one of our offerings, we help the world’s leading organizations plan for tomorrow and today. For more information, visit www.spglobal.com.
SOURCE S&P Global
Continue Reading
-

Precigen Showcases Rapid Commercialization Momentum and Growing Market Adoption of First-and-Only FDA-Approved Therapy for RRP at the 44th Annual J.P. Morgan Healthcare Conference
- Precigen transitioned to a commercial stage company with the US approval of PAPZIMEOS in August 2025, the first-and-only FDA-approved treatment for adults with RRP
- PAPZIMEOS commercialization is well underway and PAPZIMEOS is being prescribed nationwide, with patients actively receiving treatment
- PAPZIMEOS patient hub enrollment has surpassed 200 registered patients, doubling since November, and reflecting significant demand at both major medical centers and community practices
- Patient access continues to expand, with private health plan coverage now at approximately 170 million US lives, including the majority of leading insurers. PAPZIMEOS is also covered under Medicare and Medicaid
- The European Medicines Agency has validated the Marketing Authorization Application for PAPZIMEOS for the treatment of adults with RRP
- The Company continues to expect current capital resources to fund operations through cash flow break-even
GERMANTOWN, Md., Jan. 12, 2026 /PRNewswire/ — Precigen, Inc. (Nasdaq: PGEN), a commercial-stage biopharmaceutical company specializing in the advancement of innovative precision medicines to improve the lives of patients, today provided an update on the rapid commercialization momentum and growing market adoption of PAPZIMEOSTM (zopapogene imadenovec-drba), the first-and-only US Food and Drug Administration (FDA)-approved therapy for recurrent respiratory papillomatosis (RRP). Precigen’s company presentation at the 44th Annual J.P. Morgan Healthcare Conference will be on January 15, 2026 at 7:30 AM PT.
“Commercialization of PAPZIMEOS is proceeding as planned following FDA approval, with rapid and broad adoption supported by compelling safety, efficacy, and long-term durability data, expanding payer access, and strong engagement across major medical centers and community practices nationwide,” said Helen Sabzevari, PhD, President and CEO of Precigen. “We are seeing tremendous enthusiasm from physicians across the country who are eager to bring this therapy to their patients. Importantly, we are moving rapidly to make PAPZIMEOS available globally, highlighted by the European Medicines Agency validation of the Marketing Authorization Application. As the first-and-only FDA-approved therapy for adults with RRP, PAPZIMEOS is redefining the treatment paradigm, and the momentum we are seeing underscores its impact and value as we advance toward anticipated cash-flow break-even and global expansion.”
“Our commercial launch continues to build strong momentum, with patient hub enrollment doubling since November, expanding commercial health plan coverage alongside Medicare and Medicaid, and near-complete field engagement across target centers,” said Phil Tennant, Chief Commercial Officer of Precigen. “Manufacturing and supply chain capabilities are fully in place to meet current demand and anticipated growth, and patients are now receiving PAPZIMEOS nationwide. Importantly, PAPZIMEOS remains the only FDA-approved therapy for adults with RRP, providing an exclusive window to execute our commercial strategy. Based on these dynamics, we expect adoption to continue accelerating as PAPZIMEOS becomes established as the preferred first-line treatment and new standard of care.”
PAPZIMEOS: Establishing a New Standard of Care for the Treatment of Adults with RRP
- PAPZIMEOS full approval with broad label: In August 2025, the FDA granted full approval of PAPZIMEOS with a broad label and no requirement for a confirmatory trial for the treatment of adults with RRP.
- PAPZIMEOS prescribing, treatment, and distribution: PAPZIMEOS is being prescribed nationwide, with patients actively receiving treatment. PAPZIMEOS is currently shipping to prescribers across the US, supported by established cold-chain logistics and coordinated solutions to address site-level needs.
- Rapid commercialization: Rapid commercial launch execution is underway with over 96% of target centers engaged since full deployment of the sales team in September. To date, more than 200 patients have been registered in the PAPZIMEOS patient hub, doubling since November. In addition to these registered patients, a significant number of patients have been identified outside of the PAPZIMEOS hub through the Company’s field engagement efforts.
- Positive payer coverage: Private health plan coverage is progressing rapidly with approximately 170 million lives covered to date, including the majority of leading insurers. PAPZIMEOS is also covered under Medicare and Medicaid.
- Compelling long-term clinical and real-world evidence published: At AAO-HNSF 2025 and SITC 2025, the Company reported long-term durable complete responses with PAPZIMEOS, and at ISPOR Europe 2025, the Company published data demonstrating the substantial healthcare resource utilization and patient-reported quality-of-life burden of RRP, underscoring the disease’s significant clinical, economic, and human impact.
- EMA validation complete: Following a submission in November 2025, the European Medicines Agency has validated the Marketing Authorization Application for PAPZIMEOS for the treatment of adults with RRP.
About RRP
RRP is a rare, debilitating, and potentially life-threatening disease of the upper and lower respiratory tract caused by chronic HPV 6 or HPV 11 infection. RRP can lead to severe voice disturbance, compromised airways, and recurrent post-obstructive pneumonia. Although rare, RRP has the potential for transformation to malignant cancer and can be fatal. Management of RRP has primarily consisted of repeated surgeries, which do not address the underlying cause of the disease and can be associated with significant morbidity as well as significant patient and health system burden. As the number of lifetime surgeries increases, the risk for irreversible iatrogenic laryngeal injury increases with each surgery, and patients may undergo hundreds of these surgeries over their lifetimes. RRP can impact patients’ work and social lives, financial stability, and mental health. Patients with RRP can experience substantial impacts to daily living with decreased quality of life and high health care utilization. Based on an internal analysis of claims data and electronic health records, there are approximately 27,000 adult RRP patients in the US.About PAPZIMEOS (zopapogene imadenovec-drba), for subcutaneous injection only
PAPZIMEOS is the first-and-only FDA-approved therapy for the treatment of adults with RRP and the first-and-only approved therapy to address the root cause of RRP. PAPZIMEOS is a non-replicating adenoviral vector-based immunotherapy designed to express a fusion antigen comprising selected regions of human papillomavirus (HPV) types 6 and 11 proteins. PAPZIMEOS is designed to generate an immune response directed against HPV 6 and HPV 11 proteins in patients with RRP. Discovered and designed in Precigen’s labs using Precigen’s proprietary AdenoVerse therapeutic platform, PAPZIMEOS represents a new therapeutic paradigm for RRP. Full prescribing information can be found at www.precigen.com/papzimeos-prescribing-information.pdf.Precigen: Advancing Medicine with Precision®
Precigen (Nasdaq: PGEN) is a commercial-stage biopharmaceutical company specializing in the advancement of innovative precision medicines to address difficult-to-treat diseases with high unmet patient need. Precigen is dedicated to advancing scientific breakthroughs from proof-of-concept through commercialization. With a strong commitment to innovation, Precigen is developing a robust pipeline of differentiated therapies across its core therapeutic areas of immuno-oncology, autoimmune disorders, and infectious diseases. For more information about Precigen, visit www.precigen.com or follow us on LinkedIn or YouTube.Trademarks
Precigen, PAPZIMEOS, AdenoVerse, and Advancing Medicine with Precision are trademarks of Precigen and/or its affiliates. Other names may be trademarks of their respective owners.Cautionary Statement Regarding Forward-Looking Statements
This press release contains “forward-looking” statements within the meaning of the safe harbor provisions of the US Private Securities Litigation Reform Act of 1995. Forward-looking statements can be identified by words such as: “anticipate,” “intend,” “plan,” “goal,” “seek,” “believe,” “project,” “estimate,” “expect,” “strategy,” “future,” “likely,” “may,” “should,” “will” and similar references to future periods. These statements are subject to numerous risks and uncertainties that could cause actual results to differ materially from what the Company expects. Examples of forward-looking statements include, among others, information relating to the Company’s business and business plans, the success of efforts to commercialize PAPZIMEOS™ (zopapogene imadenovec-drba) for the treatment of recurrent respiratory papillomatosis (RRP) in adults, the Company’s ability to successfully obtain foreign regulatory approvals for PAPZIMEOS, expectations about the safety and efficacy of PAPZIMEOS, the ability of PAPZIMEOS to treat RRP, the Company’s future financial and operational results, and the Company’s ability to commence clinical studies or complete ongoing clinical studies for the Company’s clinical and pre-clinical stage candidates. The Company has no obligation to provide any updates to these forward-looking statements even if its expectations change. All forward-looking statements are expressly qualified in their entirety by this cautionary statement. For further information on potential risks and uncertainties, and other important factors, any of which could cause the Company’s actual results to differ from those contained in the forward-looking statements, see the section entitled “Risk Factors” in the Company’s most recent Annual Report on Form 10-K and subsequent reports filed with the Securities and Exchange Commission.Investor Contact:
Steven M. Harasym
Tel: +1 (202) 365-2563
investors@precigen.comMedia Contact:
Donelle M. Gregory
[email protected]SOURCE Precigen, Inc.
Continue Reading
-

Projects Open for Public Comment: January 12, 2026
To ensure the transparency and rigor of our standards programs, Verra invites comments from the public on whether projects seeking to register in one or more of Verra’s standards programs meet the requirements of that program. Comments received by Verra will be published to the project record on the Verra Registry and must be considered by the project proponent.
Continue Reading
-

Orbis International Appoints Kathleen Sherwin as President & CEO
Globally respected NGO leader joins Orbis to meet the growing global need for eye care
NEW YORK, Jan. 12, 2026 /PRNewswire/ — Global eye care NGO Orbis International is pleased to welcome Kathleen Sherwin as President & CEO, effective immediately. Sherwin brings more than 25 years of experience advancing health equity, gender equality and sustainable development across the nonprofit and humanitarian sectors. Her career and values strongly align with Orbis’s vision of a world where everyone can access the eye care they need to thrive.
Kathleen Sherwin, newly appointed President & CEO of Orbis International, is committed to championing eye health as a global priority.
“Kathleen’s passion for meaningful change and her unwavering commitment to equity and access strongly resonate with Orbis’s mission to eradicate curable blindness globally,” said John Slattery, Chair of the Board of Directors for Orbis International. “We are thrilled to welcome her as CEO and look forward to the impact she will help Orbis achieve for communities around the world.”
Sherwin joins Orbis at a pivotal moment as the global health landscape evolves and the need for integrated, resilient health systems becomes increasingly urgent. She is focused on accelerating Orbis’s work to prevent blindness and restore sight while elevating eye health as a global health priority.
“Eye health must be understood not as a standalone issue, but as a fundamental driver of equity, education, economic stability, and health system readiness,” Sherwin says. “Orbis has a critical role to play in ensuring eye care is fully integrated into broader health and development priorities.”
[Sherwin’s high-resolution headshot is available for download here.]
Before joining Orbis, Sherwin most recently served as Chief Strategy & Engagement Officer at Plan International, a global organization advancing children’s rights and equality for girls. In that role, she led strategy, partnerships, fundraising, communications, and policy, strengthening the organization’s global profile and long-term impact.
Sherwin’s leadership has been consistently shaped by a commitment to advancing the health and rights of women and girls. She previously held senior roles at Women Deliver, including Interim President & CEO, and at Planned Parenthood Federation of America.
Sherwin’s appointment marks an exciting new chapter for Orbis. Her strategic vision, global experience, and collaborative leadership will guide the organization as it continues working toward a future where everyone, everywhere, has access to quality eye care and the opportunity to reach their full potential.
About Orbis International
Orbis International works around the world to prevent blindness and restore sight for children and adults in places where eye care is out of reach—so vision problems don’t make it harder to learn, earn a living, or enjoy life. Around 1.1 billion people live with vision loss, but with the right care, 90% of it is completely avoidable. That is why Orbis trains doctors, nurses, and other eye care professionals to provide care in their own communities—and works to make sure people of all ages can access the eye exams, glasses, medicine, and surgeries they need to protect and restore their sight. Orbis began this work more than 40 years ago with the Flying Eye Hospital, a teaching hospital on a plane that brings expert training and care where they’re needed most. Today, we also work with local hospitals and clinics across Africa, Asia, and Latin America to make eye care available to more people, and we use and develop technology—like our award-winning Cybersight e-learning and telehealth platform, artificial intelligence screening, and virtual reality training—to help eye care teams treat patients more effectively. Orbis ranks in the top 3% of U.S. charities, having earned top marks for transparency and accountability from Charity Navigator, GuideStar, and the Better Business Bureau. To learn more, please visit orbis.org.
Media Contact
Jenna Montgomery
Associate Director, Global Communications and Marketing
Orbis International
[email protected]SOURCE Orbis International
Continue Reading
-

Trump faces extraordinary moment in spat with Fed chair Powell
Faisal IslamEconomics editor
ReutersIt is extraordinary enough to see the world’s top central banker make an unscheduled video statement on social media. My first thought upon seeing the post from the Federal Reserve chair Jerome Powell was: “Is this an AI deepfake?”
That sense did not go away as I listened to what were indeed the real words of the world’s most important financial official.
The background here is a long-running spat between President Trump and the man responsible for setting interest rates in the US and indirectly much of the rest of the world.
In theory, this has officially been about the cost of a renovation project at the Federal Reserve, the US equivalent of the Bank of England. The president even took his motorcade over to the Fed’s building to inspect the work.
At the same time, President Trump has attempted to criticise, interfere and influence the highly independent setting of interest rates by Powell, through criticism and the appointment of his own favourite economists. The aim appears to be to try to massage down US interest rates.
In the early hours of this morning, a softly spoken Powell revealed that the Department of Justice (DoJ) had served his institution with criminal indictments over his testimony on the building works. But he also said publicly what he had not before. The “unprecedented” DoJ moves “should be seen in the broader context of the administration’s threats and ongoing pressure”.
Actions over the Fed building were “pretexts”, he said. “The threat of criminal charges is a consequence of the Federal Reserve setting interest rates based on our best assessment of what will serve the public, rather than following the preferences of the president.”
There are unhappy international precedents for this in developing and emerging economies, where independent central bank governors can often be the first to see the wrath of elected governments attempting to shake off the restraints of expert institutions. Think Turkey and Zimbabwe.
Powell said this morning: “This is about whether the Fed will be able to continue to set interest rates based on evidence and economic conditions, or whether instead, monetary policy will be directed by political pressure or intimidation.”
This matters not just technically for American mortgage rates or US markets. Federal Reserve independence is the anchor for stability across global markets. This is not to say they always make the right decisions or are beyond criticism. But Powell is suggesting in clear terms that this is something much bigger than that.
In a different context, during the infamous Liz Truss mini-budget, it was noises from Truss backers raising questions about the Bank of England that contributed to the chaos.
In this context, it is worth watching the key market for US Treasuries, the safe haven asset of choice in times of instability. Will they respond to Powell’s public words, or the threat of criminal action?
It might be argued that Powell’s term is up in May and he will be replaced, probably by a Trump-friendly economist, so does not make a difference. It does raise the stakes however. US interest rates are decided by a committee vote, not just the chair.
There has been some wild talk that the US administration could choose to weaponise some of the Fed’s powerful global markets tools to coerce other countries in its tariff war, including allies. Bluntly, that use of what is known as swap lines, massive dollar funding at times of stress, would not have been possible under Powell. Is that where this is now going?
More broadly it is difficult to detach the Powell intervention from what is going on elsewhere in the US. In recent days we have seen the deployment of militarised immigration police, routine threats the US could acquire sovereign territory from Nato allies, while the Supreme Court is about to confirm if his main economic policy has been illegal.
There are some Republicans in Congress who will feel deeply uncomfortable about this Powell development in particular. The head of a central bank is someone with an alternative pole of power who, by design, must speak truth to power.
Even Powell’s unscheduled appearance might cause a reaction in markets, as occurred when Andrew Bailey spoke to BBC cameras in Washington DC in the middle of the mini-budget crisis.
It is worth noting that the most significant moment of pause in the Trump agenda occurred last April, when the chaotic approach to tariffs fell foul of the global bond markets before the stabilising influence of the Treasury Secretary Scott Bessent took control.
The Powell moment could see a repeat.
Continue Reading
-

What caused Instagram’s password change emails? Company dismisses data breach rumours
What caused Instagram’s password change emails? Company dismisses data breach rumours The internet was in a constant state of frenzy over the past few days as Instagram users received suspicious password change emails; however, the Meta-owned photo and video-sharing platform has denied falling prey to any breaches.
The purported, suspicious-looking password reset emails caused fears of a big-scale hack.
Directly addressing the situation on Sunday, the company noted that the influx of emails was a technical glitch, not a cyberattack.
Was Instagram users’ data really stolen?
This official denial is in direct contradiction with earlier reports, as antivirus software company Malwarebytes on January 9 shared a concerning update on Bluesky, claiming that cybercriminals successfully stole sensitive information from 17.5 million Instagram accounts.
As per the antivirus company, this compromised data includes usernames, physical addresses, phone numbers, and email addresses. The Bluesky post also warned that this data is available for sale on the dark web and is likely to be abused by cybercriminals.
Why instagram sent password reset emails?
Notwithstanding such grave allegations, Instagram, in a post on X, clarified that user data is safe, while admitting that they fixed an issue that allowed an external party to request password reset emails for some people.
The Meta-owned platform did not provide specific details about this external party or the nature of the issue; instead, it simply advised users to disregard the notifications.
Continue Reading
-
Oil dips as investors assess Iran supply, Venezuelan export resumption – Reuters
- Oil dips as investors assess Iran supply, Venezuelan export resumption Reuters
- Natural Gas and Oil Forecast: WTI & Brent Rebound on Breakouts Despite 2026 Oversupply Fears FXEmpire
- Crude Oil Prices Boosted by Dollar Weakness and Iranian Protests TradingView — Track All Markets
- Brent price stock BRNT slips in London as Iran headlines cool and Venezuela barrels line up TechStock²
- US, Iran, and Middle East Risks Lift WTI Near $60 FOREX.com
Continue Reading