Category: 7. Science

We consider humans to be at the apex of social cognition. But we’re not the only animals that closely interact with each other. Marmosets, for example, are highly social creatures. In the wild, they choose to work together, sharing food and helping each other raise young.

In a new study, published Aug. 28 in Current Biology, Yale researchers, collaborating across Yale School of Medicine (YSM) and the Faculty of Arts and Sciences (FAS), created a novel approach for closely observing marmoset behavior. Combined with computational modeling, the study revealed sophisticated cooperative strategies utilized by marmoset pairs.

This new system could help improve the way psychologists study social cognition and lead to a better understanding of disorders in which it is impaired, such as autism spectrum disorder.

“This particular study established a paradigm that allows us to obtain high throughput behavioral data,” says Monika Jadi, PhD, associate professor of psychiatry at YSM and co-principal investigator. “So, we can now start probing the brain areas that are involved in social cognition and understanding how they are involved.”

The current established paradigm for studying marmoset social cognition is cumbersome and limits the amount of data researchers can obtain. “It’s not ideal for studying complex behavior dynamics,” says Steve Chang, PhD, associate professor of psychology in FAS and co-principal investigator.

Furthermore, the paradigm involves manually observing and scoring behaviors. “It’s a slow and error-prone process, which does not provide mechanistic insights into what the animals are doing,” says Anirvan Nandy, PhD, associate professor of neuroscience and co-principal investigator.

We can now start probing the brain areas that are involved in social cognition and understanding how they are involved.

In the new study, the team used a new apparatus that they developed—Marmoset Apparatus for Automated Pulling—which requires a pair of marmosets to work together, pulling levers within a certain timeframe in order to receive a reward. The researchers also set up cameras around the apparatus, enabling them to track moment-by-moment where the animals were looking.

This rich set of behavioral data allowed the team to build a computational model for understanding the various cooperative strategies that the marmosets utilized.

Marmosets show flexibility during cooperation

The researchers discovered that marmosets used different types of strategies to cooperate. In some cases, one marmoset would monitor what the other was doing to help time its pull, which researchers refer to as a “social gaze-dependent strategy.” In other instances, the animals got into a rhythm and synchronized their pulls without looking at each other, using a “social gaze-independent strategy.”

The marmosets showed flexibility when choosing strategies. When the duo was performing well, they tended to use social gaze-independent rhythmic pulling. But at times when they struggled to synchronize, they switched to social gaze-dependent strategies. In other words, the animals would look at each other more as they strived to find a rhythm.

The primates also chose different strategies based on their partner. For instance, if one marmoset struggled to pull the lever within the allotted time frame, the researchers found that its partner would adapt, such as pulling the lever twice to give the first marmoset more time. But when paired with a new partner who did not struggle with timing, the marmoset would revert to pulling only once.

“Pulling strategies of the same monkey can alternate back and forth,” says Chang. “They are using partner identity to adjust how they are interacting with the device.”

Furthermore, the dominant member of the pair tended to pull the lever after the subordinate. “The dominant was monitoring what the subordinate was doing and timing their pulls,” says Nandy.

The findings highlighted how marmosets proactively looked for ways to cooperate with one another. “They’re motivated to figure out the best way to work together for mutual benefit,” says Chang. “And they can adjust their strategies to achieve that benefit.”

Expanding our understanding of social cognition

The researchers are now combining their new system with neural recording to better understand how neurons encode cooperative strategies. Down the road, this type of research could lead to better understanding of disorders such as autism spectrum disorder, in which individuals often struggle with behavioral rigidity.

“This work opens up a whole realm of possibilities around studying complex social cognition at large,” says Nandy.

Olivia Meisner, PhD, a former graduate student from YSM’s Interdepartmental Neuroscience Program, and Weikang Shi, PhD, a Wu Tsai Institute postdoctoral fellow, were co-first authors of the study.

This work was supported by the National Science Foundation (award DGE2139841), the National Institute of Mental Health (award R21MH126072), the National Eye Institute (award P30EY026878), and Yale University. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or National Science Foundation. Additional support was provided by the Simons Foundation Autism Research Initiative and the Wu Tsai Institute.

The world has far fewer places to securely store carbon dioxide deep underground than previously thought, steeply lowering its potential to help stem global warming, according to a new study that challenges long-held industry claims about the practice.

The study, published Wednesday in the journal Nature, found that global carbon storage capacity was 10 times less than previous estimates after ruling out geological formations where the gas could leak, trigger earthquakes or contaminate groundwater, or had other limitations. That means carbon capture and storage would only have the potential to reduce human-caused warming by 0.7 degrees Celsius (1.26 Fahrenheit) — far less than previous estimates of around 5-6 degrees Celsius (9-10.8 degrees Fahrenheit), researchers said.

“Carbon storage is often portrayed as a way out of the climate crisis. Our findings make clear that it is a limited tool” and reaffirms “the extreme importance of reducing emissions as fast and as soon as possible,” said lead author Matthew Gidden, a research professor at the University Maryland’s Center for Global Sustainability. The study was led by the International Institute for Applied Systems Analysis, where Gidden also is a senior researcher in the energy, climate and environment program.

The study is the latest knock on a technology, for years promoted by oil and gas industry, that has often been touted as a climate solution. Today, carbon capture is far from being deployed at scale, despite billions of dollars in investments around the world, and the amount of carbon currently captured is just a tiny fraction of the billions of tons of carbon dioxide emitted every year.

Challenging assumptions

The 2015 Paris Agreement called for limiting average global temperature increase to 2 degrees Celsius (3.6 degrees Fahrenheit), but ideally below 1.5C (2.7F), compared to the early 1800s.

Many scenarios for achieving that have relied on carbon removal and storage, assuming the potential was “very large” because previous estimates didn’t account for vulnerable areas that might not be suitable, said study co-author Alexandre Koberle, a researcher at the University of Lisbon.

“That was never systematically challenged and tested,” said Koberle, adding that the study was the first to examine which areas should be avoided, leading to what they call a “prudent potential” that minimizes risks to people and the environment.

That’s not to say that carbon capture and storage isn’t important to keep global temperatures in check — but countries must prioritize how they use the limited storage and do so in conjunction with fast and deep emissions reductions, researchers said.

The technology ideally should be used for sectors that are difficult to decarbonize, such as cement production, aviation and agriculture, rather than to extend the life of polluting power plants or to prolong the use of oil and gas, Koberle said.

Industry officials defended carbon capture and storage as having an inherently low risk and say emerging technologies, such as storing carbon dioxide in basalt formations where it becomes mineralized, could dramatically increase total storage volumes.

What’s more, its use is “not optional if we hope to address global warming,” said Jessie Stolark, executive director of the Carbon Capture Coalition, adding that it must be combined with other ways to reduce emissions and balanced with the need for reliable and affordable energy.

Rob Jackson, head of the Global Carbon Project, a group of scientists who monitor greenhouse gas emissions, praised the study for its cautionary perspective. And though he’s optimistic that carbon capture technology itself will work, he believes very little will ever be stored “because I don’t think we’re willing to pay for it.”

“If we aren’t willing to cut emissions today, why do we expect that people in the future will just automatically pay to remove our pollution?” Jackson said. “We’re just continuing to pollute and not addressing the root of the problem.”

How it works

Carbon dioxide, a gas produced by burning fossil fuels, traps heat close to the ground when released to the atmosphere, where it persists for hundreds of years and raises global temperatures.

Industries and power plants can install equipment to separate carbon dioxide from other gases before it leaves the smokestack, or it can be captured directly from the atmosphere using giant vacuums.

Captured carbon is compressed and shipped to a location where it can be injected deep underground for long-term storage in deep saline or basalt formations and unmineable coal seams — though about three-fourths is pumped back into oil fields to build pressure to help extract more oil.

In the U.S., such projects have faced criticism from some conservatives, who say it is expensive and unnecessary, and from environmentalists, who say it has consistently failed to capture as much pollution as promised and is simply a way for producers of fossil fuels like oil, gas and coal to continue their use.

The most commonly used technology allows facilities to capture and store around 60% of their carbon dioxide emissions during the production process. Anything above that rate is much more difficult and expensive, according to the International Energy Agency.

Gidden, the lead author, said it’s clear that scaling up carbon storage will be important to achieving net-zero emissions and to eventually reduce them, and said the use of basalt formations is promising. But the world cannot wait for that to happen before acting decisively to slash fossil fuel emissions.

“If we prolong our dependence on fossil fuels for too long with the expectation that we will offset that by simply storing carbon underground, we’re likely saddling future generations with a nearly impossible task of dealing with not only our mess, but limited ways of cleaning it up,” he said.

___

The Associated Press’ climate and environmental coverage receives financial support from multiple private foundations. AP is solely responsible for all content. Find AP’s standards for working with philanthropies, a list of supporters and funded coverage areas at AP.org.

The world has far fewer places to securely store carbon dioxide deep underground than previously thought, steeply lowering its potential to help stem global warming, according to a new study that challenges long-held industry claims about the practice.

The study, published Wednesday in the journal Nature, found that global carbon storage capacity was 10 times less than previous estimates after ruling out geological formations where the gas could leak, trigger earthquakes or contaminate groundwater, or had other limitations. That means carbon capture and storage would only have the potential to reduce human-caused warming by 0.7 degrees Celsius (1.26 Fahrenheit) — far less than previous estimates of around 5-6 degrees Celsius (9-10.8 degrees Fahrenheit), researchers said.

“Carbon storage is often portrayed as a way out of the climate crisis. Our findings make clear that it is a limited tool” and reaffirms “the extreme importance of reducing emissions as fast and as soon as possible,” said lead author Matthew Gidden, a research professor at the University Maryland’s Center for Global Sustainability. The study was led by the International Institute for Applied Systems Analysis, where Gidden also is a senior researcher in the energy, climate and environment program.

The study is the latest knock on a technology, for years promoted by oil and gas industry, that has often been touted as a climate solution. Today, carbon capture is far from being deployed at scale, despite billions of dollars in investments around the world, and the amount of carbon currently captured is just a tiny fraction of the billions of tons of carbon dioxide emitted every year.

Challenging assumptions

The 2015 Paris Agreement called for limiting average global temperature increase to 2 degrees Celsius (3.6 degrees Fahrenheit), but ideally below 1.5C (2.7F), compared to the early 1800s.

Many scenarios for achieving that have relied on carbon removal and storage, assuming the potential was “very large” because previous estimates didn’t account for vulnerable areas that might not be suitable, said study co-author Alexandre Koberle, a researcher at the University of Lisbon.

“That was never systematically challenged and tested,” said Koberle, adding that the study was the first to examine which areas should be avoided, leading to what they call a “prudent potential” that minimizes risks to people and the environment.

That’s not to say that carbon capture and storage isn’t important to keep global temperatures in check — but countries must prioritize how they use the limited storage and do so in conjunction with fast and deep emissions reductions, researchers said.

The technology ideally should be used for sectors that are difficult to decarbonize, such as cement production, aviation and agriculture, rather than to extend the life of polluting power plants or to prolong the use of oil and gas, Koberle said.

Industry officials defended carbon capture and storage as having an inherently low risk and say emerging technologies, such as storing carbon dioxide in basalt formations where it becomes mineralized, could dramatically increase total storage volumes.

What’s more, its use is “not optional if we hope to address global warming,” said Jessie Stolark, executive director of the Carbon Capture Coalition, adding that it must be combined with other ways to reduce emissions and balanced with the need for reliable and affordable energy.

Rob Jackson, head of the Global Carbon Project, a group of scientists who monitor greenhouse gas emissions, praised the study for its cautionary perspective. And though he’s optimistic that carbon capture technology itself will work, he believes very little will ever be stored “because I don’t think we’re willing to pay for it.”

“If we aren’t willing to cut emissions today, why do we expect that people in the future will just automatically pay to remove our pollution?” Jackson said. “We’re just continuing to pollute and not addressing the root of the problem.”

How it works

Carbon dioxide, a gas produced by burning fossil fuels, traps heat close to the ground when released to the atmosphere, where it persists for hundreds of years and raises global temperatures.

Industries and power plants can install equipment to separate carbon dioxide from other gases before it leaves the smokestack, or it can be captured directly from the atmosphere using giant vacuums.

Captured carbon is compressed and shipped to a location where it can be injected deep underground for long-term storage in deep saline or basalt formations and unmineable coal seams — though about three-fourths is pumped back into oil fields to build pressure to help extract more oil.

In the U.S., such projects have faced criticism from some conservatives, who say it is expensive and unnecessary, and from environmentalists, who say it has consistently failed to capture as much pollution as promised and is simply a way for producers of fossil fuels like oil, gas and coal to continue their use.

The most commonly used technology allows facilities to capture and store around 60% of their carbon dioxide emissions during the production process. Anything above that rate is much more difficult and expensive, according to the International Energy Agency.

Gidden, the lead author, said it’s clear that scaling up carbon storage will be important to achieving net-zero emissions and to eventually reduce them, and said the use of basalt formations is promising. But the world cannot wait for that to happen before acting decisively to slash fossil fuel emissions.

“If we prolong our dependence on fossil fuels for too long with the expectation that we will offset that by simply storing carbon underground, we’re likely saddling future generations with a nearly impossible task of dealing with not only our mess, but limited ways of cleaning it up,” he said.

___

The Associated Press’ climate and environmental coverage receives financial support from multiple private foundations. AP is solely responsible for all content. Find AP’s standards for working with philanthropies, a list of supporters and funded coverage areas at AP.org.

• RESEARCH BRIEFINGS
• 03 September 2025

Experimental animals and embryo collection

D. melanogaster embryos were collected on apple juice agar plates with yeast paste at 22 °C or at the temperatures indicated below. Laboratory cultures of M. abdita (Sander strain) were maintained as described⁵². M. abdita embryos were collected on apple juice agar plates with fish food paste at 25 °C. The laboratory cultures of C. riparius (Bergstrom strain) were maintained as described⁵². C. riparius embryos were collected as freshly deposited egg packages at ambient room temperature (23–26 °C). The laboratory cultures of C. albipunctata were maintained as described^53,54. Embryos were obtained after dissecting-out adult female ovarioles, followed by experimental egg activation through a hypo-osmotic shock. The laboratory cultures of H. illucens were established from existing cultures in the Schmidt-Ott lab (University of Chicago). To collect H. illucens embryos, females were decapitated to trigger egg laying at the desired time.

A transient laboratory culture of C. fuscipes was established from wild-caught adults found near the municipal compost plant of the city of Heidelberg. C. fuscipes adults prefer to lay eggs in small cavities. To collect embryos, old culture plates of C. albipunctata were used as they conveniently have such cavities. Before using these for C. fuscipes egg collection, the plates were decontaminated by freezing them at −20 °C for at least 1 week, followed by thawing overnight at room temperature.

We could not establish a laboratory culture for any of the species from the family Empididae, because we could not optimise the culture conditions. During our excursion in Pula (Croatia) we managed to catch a few adults of an Empis species (most probably Empis pennipes, referred to as Empis sp. throughout the text). As a result, we resorted to repeatedly catching adults during that time from the wild, and then decapitated the females to trigger egg laying.

Drosophila genetics and transgenic lines

D. melanogaster lines used for live imaging were MyoII–eGFP (also known as Spaghetti-squash–eGFP, or Sqh–eGFP)⁵⁵, Gap43-mCherry⁵⁶, MyoII-mKate2 (ref. ⁵⁷) and mat-tub-3xmScarlet-CaaX (this study). The membrane imaging line mat-tub-3xmScarlet-CaaX was made by cloning 3xmScarlet-CaaX into the pBabr vector containing the mat-tub promoter (gift from D. St. Johnston, Gurdon Institute, UK)⁵⁸ and the sqh 3′ untranslated region (UTR), followed by ΨC31 site-directed integration into the attP2 or attP40 landing sites at WellGenetics. D. melanogaster mutant alleles used were eve^R13 (FlyBase ID: FBal0003885), btd^AX (FlyBase ID: FBal0030657), stg^7M53 (FlyBase ID: FBal0016176) and the quadruple mutant³³ knirps^IID48 (FlyBase ID: FBal0005780) hunchback^7M48 (FlyBase ID: FBal0005395) forkhead^E200 (FlyBase ID: FBal0004007) tailless^L10 (FlyBase ID:FBal0016889). Descriptions of phenotypes associated with eve^R13 (http://flybase.org/reports/FBal0003885.htm) and btd^AX (http://flybase.org/reports/FBal0030657.htm) were obtained from FlyBase (release FB2025_03)⁵⁹. In live imaging experiments, the mutant embryos were identified on the basis of the absence of a balancer-linked reporter construct, hb0.7-Venus-NLS, inserted on the FM7h, CyO or TM3 balancer¹².

To generate the eve1^KO line, an eve genomic rescue construct, eve^CH322-103K22-mNeonGreen, was first created using P[acman]^CH322-103K22 (BACPAC Resources Center), a BAC construct that encompasses the entire eve locus, from which the stop codon of eve was replaced with a standard protocol^60,61 with mNeonGreen following a linker (N-ter-GSAGSAAGSGEV-C-ter). To completely eliminate eve expression in the Eve1 region, the stripe1 (+6.6 to +7.4 kb relative to the transcriptional start site of eve)²⁵ and late element (−6.4 to −4.8 kb)²⁴ enhancers were deleted from eve^CH322-103K22-mNeonGreen through homologous recombination using the following homology arm sequences: stripe1 left, GCAAGTCCGAGACAAATCCACAAATATTGTCAACTCTTTGGCTCTAATCTG; right, CCAAGGCCGCAAAGTCAACAAGTCGGCAGCAAATTTCCCTTTGTCCGGCGA; and late element left, TTGCGTTTGAGCTACGTTACTTACATTTTTCCCACATGAGTCGGGCATACA; right, TCGATGGGTTGGTCACAATGTGGTGGCCTCTCAACATTGCAAGGCTCTTAC. The resultant BAC construct, eve^CH322-103K22-mNeonGreenΔst1ΔLE (Extended Data Fig. 4a) was integrated into PBac{y[+]-attP-3B}VK00033 at Rainbow Transgenics, and crossed into the eve^R13 mutant line to generate the eve1^KO line. Identification of eve1^KO embryos in live imaging experiments was performed as above, on the basis of the absence of a balancer-linked reporter construct, hb0.7-Venus-NLS, inserted on the CyO¹².

For Insc overexpression, males of UAS-insc were crossed to females containing two copies of nos-GAL4-GCN4-bcd3’UTR, which directs targeted gene expression in the head region of resultant embryos⁶². These female flies also contained transgenes for the imaging markers Sqh–eGFP and 3xmScarlet-CaaX. The flies were incubated at 22 °C for embryo collection. For Opto-DNRho1 experiments, females of UASp-CIBN-CaaX; UASp-CRY2-Rho1[N19, Y189]²⁷ (a gift from B. He, Dartmouth College, USA) were crossed to males of matαTub-Gal4VP16^67C; matαTub-Gal4VP16¹⁵ double driver line that also contains the transgene for mat-tub-3xmScarlet-CaaX imaging marker. The resultant F1 flies were used to set up egg deposition cages that were kept at 18 °C for collection of embryos used in the experiments.

Protein tree

Predicted protein sequences of eve and btd were used as queries to identify closely related genes in D. melanogaster and putative orthologues in M. abdita and C. riparius using BLAST. Protein alignments were performed in Geneious by MUSCLE alignment with standard parameters. The protein tree was assembled using Jukes–Cantor as the genetic distance model and UPGMA (unweighted pair group method with arithmetic mean) for tree building, with a bootstrap of 1,000 replicates.

Cloning, and messenger RNA and double-stranded RNA synthesis

Cri-btd, Cri-eve, Cri-insc, Cri-sqh, Mab-btd and Mab-eve were identified from published transcriptome sequences and cloned after polymerase chain reaction amplification from complementary DNA. In vivo labelling of cell outlines and MyoII in C. riparius used Gap43-linker–eGFP and Cri-Sqh-linker–eGFP, which were expressed in the embryo by the injection of in vitro synthesized messenger RNAs. The Gap43-linker–eGFP fusion construct for mRNA synthesis was generated by in-frame Gibson assembly of the Gap43 encoding sequence, a short linker (GSAGSAAGSGEV), and a previously published pSP35T expression vector (pSP-Mab-bsg–eGFP) that contained a 3′-terminal eGFP⁶³. Analogously, the Cri-Sqh-linker–eGFP fusion construct was generated using a full-length fragment of Cri-sqh amplified by polymerase chain reaction from cDNA. Nascent mRNAs were generated using SP6 polymerase, followed by capping and poly(A)-tailing with dedicated capping and poly(A) kits (CELLSCRIPT). Synthesized mRNA was dissolved in H₂O.

For btd RNAi experiments in D. melanogaster, double-stranded RNA was synthesized on templates that contain the T7 promoter sequence (5′-TAATACGACTCACTATAGGGTACT-3′) at each end using a MEGAscript T7 kit (Ambion); templates were amplified from 0–4 h embryonic cDNA using specific primers (5′-AGCAGATGACGACGACAACA-3; 5′-TACTCGGACTTCATGTGGCA-3). For insc RNAi experiments in C. riparius, dsRNA was synthesized as previously described⁶³. The dsRNAs comprised the following gene fragments (position 1 refers to first nucleotide in the open reading frame): btd, position 1,487 to 1,817; Cri-insc (GenBank PV919477), position 466 to 1,892.

Injections

For dsRNA injections in D. melanogaster, 0–1 h-old (up to stage 2) embryos were collected, dechorionated with bleach and mounted on an agar pad. The mounted embryos were then picked up using a coverslip painted with glue (prepared by immersing bits of Scotch tape in heptane), desiccated for 10–14 min using Drierite (W. A. Hammond Drierite Co.) and covered with a mixture of Halocarbon oil 700 and 27 (Sigma-Aldrich) at a ratio of 3:1. Needles for injection were prepared from micro-capillaries (Drummond Microcaps, outer diameter 0.97 mm, inner diameter 0.7 mm) pulled with a Sutter P-97/IVF and bevelled with a Narishige pipette beveller (EG-44). Injections were performed on a Zeiss Axio Observer D1 inverted microscope using a Narishige manipulator (MO-202U) and microinjector (IM300). A volume of ~144 pl of solution with a concentration of 1.1–1.6 μg μl⁻¹ or 8–12 μg μl⁻¹ dsRNA was injected into the embryo. Embryos were kept at 25 °C after injection in a moist chamber until early to mid-cellularization, followed by live imaging.

For injections in C. riparius, embryos were collected, prepared and injected essentially as described previously⁵². Embryos were injected before the start of cellularization (~4 h after egg deposition), and then kept in a moist chamber until the onset of gastrulation. Throughout all procedures, embryos were kept at 25 °C (±1 °C). Owing to their small size, C. riparius embryos (200 µm length) were always injected into the centre of the yolk (50% of anterior–posterior axis). Embryos were injected with dsRNA typically at concentrations of 300 to 700 ng ml⁻¹; mRNA was injected typically at concentrations of 1.5–2.5 μg μl⁻¹ (Cri-Gap43–eGFP and Cri-Sqh–eGFP). LifeAct-mCherry was injected as a recombinant protein as previously described at ~4.5 mg ml⁻¹ (ref. ⁶³).

Live imaging

Live imaging of D. melanogaster embryos was performed using two-photon scanning microscopy with a 25× water immersion objective (numerical aperture = 1.05) on an upright Olympus FVMPE-4GDRS system (InSight DeepSee pulsed IR Dual-Line laser, Spectra Physics) or an inverted Olympus FVRS-F2SJ system (Maitai and InSight DeepSee lasers), or a Plan-Apochromat 25× oil immersion objective (numerical aperture = 0.8) on a Zeiss LSM980 inverted microscope (Chameleon laser, Coherent Int). Excitation wavelengths were 920 nm for eGFP, 950 nm for Venus and 1,040 nm (upright) or 1,100 nm (inverted) for mKate2, mCherry or mScarlet. Three imaging settings were used with the following parameters (total z depth, xy dimension of the imaging region of interest (ROI), z-step size, time interval, imaging angle or view): (1) ~80 µm, 539.5 × 185.5 µm, 2 µm, 90 s, whole-embryo lateral or ventral views; (2) ~60 µm, 253.5 × 152 µm, 1.5 µm, 50 s, head domain; (3) ~40 µm, 208.3 × 152 µm, 1 µm, 45 s, cell division in head MDs. Embryos were collected, dechorionated and mounted on coverslips or glass-bottom dishes, and immersed in 1× phosphate-buffered saline for imaging.

Live imaging of C. riparius embryos was performed on a Leica SP8 confocal using a 63× glycerol immersion objective (numerical aperture = 1.30). z-stacks of ~25 µm depth were acquired at a z-step size of 1 µm and 90 s time interval. All recordings were performed at 25 °C.

Time-lapse imaging to visualize GBE was performed on Nikon Eclipse-Ti microscope in differential interference contrast mode, using a 20× objective (numerical aperture = 0.8) for D. melanogaster, M. abdita, C. riparius and C. albipunctata, with 1 frame every 1 min; on a Leica SP5 DMI6000CS inverted confocal microscope in transmission illumination mode, using a 40× objective (numerical aperture = 1.1) for C. fuscipes, with 1 frame every 2 min; and on Zeiss Colibri upright microscope in differential interference contrast mode, using a 10× objective (numerical aperture = 0.45) for H. illucens and a 20× objective (numerical aperture = 0.5) for Empis sp., with 1 frame every 3 min. All recordings were performed at 25 °C.

Optogenetics

The Opto-DNRho1 system²⁷ was used as previously reported. To prevent unwanted photo-activation, Fly crosses and cages were kept in the dark and embryos were processed, staged and mounted in a dark room with a light source covered by a light red filter (no. 182, Lee Filters). Imaging was performed on an Olympus FVMPE-RS (InSight DeepSee pulsed IR Dual-Line laser system, Spectra Physics) with a 25× (numerical aperture = 1.05) water immersion objective and excitation wavelength of 1,040 nm for the membrane marker 3xmScarlet-CaaX. The efficacy of MyoII inhibition with the Opto-DNRho1 system was first benchmarked on ventral furrow formation to confirm that it resulted in a complete blockage of apical constriction²⁷.

Two photo-activation protocols were used: protocol no. 1 used a 405 nm diode laser at 0.1% power (5.48 µW) and protocol no. 2 used a 458 nm diode laser at 0.5% power (27.14 µW), both scanned at 2 µs per pixel. Sham controls were performed at 0% laser power. The photo-activation ROI was illuminated for 3 s in all experiments.

Three experimental designs were used: (1) lateral imaging with unilateral photo-activation (Fig. 2h,i, Extended Data Fig. 5a and Supplementary Video 4) used protocol no. 1 on a 28.15 × 197.05 µm ROI (50 × 350 pixels) centred on ‘the pre-CF domain’⁶⁴ covering the entire region of CF initiation along the dorso-ventral circumference, beginning 16–33 min before gastrulation and repeated every 90 s; (2) ventral imaging with bilateral photo-activation (Fig. 4a,b and Supplementary Video 7) used protocol no. 1 on two 33.78 × 33.78 µm ROIs (60 × 60 pixels) each covering one side of the CF, beginning 18–30 min before gastrulation and repeated every 180 s; and (3) ventral imaging with bilateral photo-activation and long-term imaging (Fig. 4d,e and Supplementary Video 8) used protocol no. 2 on two 28.8 × 28.8 µm ROIs (40 × 40 pixels) each covering one side of the CF, beginning 15–30 min before gastrulation and repeated every 180 s for 1 h, followed by time-lapse imaging at 10 or 20 min per frame for 18–23 h.

Immunofluorescence and fixed imaging

For antibody staining, embryos were fixed by a heat–methanol method⁶⁵ and immunostained with mouse monoclonal anti-Neurotactin (1:20, BP106, Developmental Studies Hybridoma Bank, USA), rabbit polyclonal anti-Eve (1:500, gift from M. Biggin, Lawrence Berkeley National Laboratory, USA), and rat polyclonal anti-Btd (1: 500, gift from E. Wieschaus, Princeton University, USA), followed by DAPI staining to visualize nuclei. Imaging was performed on a Leica SP8 system using a 20× (numerical aperture = 0.75) multi-immersion objective with oil immersion (total z depth: 60–90 µm, z-step size: 1.04 µm).

For DNA staining, embryos were fixed by heat and devitellinized as described⁶⁶, followed by staining with DRAQ5 (1:1,000 for 1 h, Thermo Fisher Scientific, catalogue number 62251). Imaging was performed on a Leica SP8 system with a 20× glycerol objective (numerical aperture = 0.75) for D. melanogaster, M. abdita, H. illucens and C. albipunctata, and a 63× glycerol objective (numerical aperture = 1.3) for C. fuscipes and C. riparius, with a z-step size of 1 µm in a z-range that covers at least half of the embryo.

For the hybridization chain reaction (HCR), embryos were fixed by heat and devitellinized as described⁵⁴, probes for Cri-btd and Cri-eve were generated using previously published software⁶⁷ (https://github.com/rwnull/insitu_probe_generator) and ordered through Sigma-Aldrich. HCR amplifiers (B1-Alexa488 for Cri-eve; B2-Alexa594 for Cri-btd) were obtained from Molecular Instruments. Devitellinized embryos were re-hydrated in a series of 1× phosphate-buffered saline with Tween (PBT) and post-fixed for 40 min with 4% paraformaldehyde in PBT on a shaker. Following PBT washes, we followed the In situ HCR v.3.0 protocol⁶⁸ for whole-mount fruit fly embryos Revision 9 (13 February 2023) from Molecular Instruments. We then stained the embryos with DRAQ5 in 5× saline-sodium citrate with Tween (1:1,000 for 1 h) and mounted the embryos in 50% glycerol in 5× saline-sodium citrate with Tween. Imaging was performed as above for DNA staining in Chironomus riparius.

For in situ hybridization, embryos were fixed by a heat–formaldehyde method⁶³. Transcripts were detected histochemically or fluorescently as described⁶⁹, using RNA probes for Mab-btd (comprising 1,473 nucleotides from +1 to 1,473, with position +1 referring to first nucleotide in the open reading frame), Mab-eve (comprising 984 nucleotides, from position 365 to 996 of the putative coding sequence and 351 nucleotides of the 3′ UTR), and Cri-insc (comprising 1,427 nucleotides from 466 to 1,892) labelled with either digoxigenin or fluorescein. M. abdita embryos were also stained with DAPI to visualize nuclei.

Image processing and quantification

Images were processed, assembled into figures and converted into videos using FIJI, Affinity Designer, Adobe Illustrator and HandBrake. Quantitative data were analysed and processed using Excel, or custom-made ImageJ or FIJI macros and Python scripts using Numpy, Pandas and SciPy libraries. Plots were generated in GraphPad Prism or with Python scripts using Matplotlib and Seaborn graphic libraries. Detailed descriptions of image processing and analysis procedures are provided in Supplementary Methods.

Statistical analyses

All of the statistical details of experiments, including the number of experiments (n), which represents the number of embryos used unless otherwise noted, are given in the figure legends. Python scripts using SciPy library were implemented to perform one-way ANOVA followed by Tukey’s multiple comparison post hoc test for comparing means from more than two groups, and Mann–Whitney U-test was used as a non-parametric independent test for comparing two means. GraphPad Prism was used: (1) to perform statistical analyses to compare the blastoderm cell densities across species, including the calculation of medians and the 95% confidence intervals on the median, and one-way ANOVA with Kruskal–Wallis non-parametric test, without correcting for multiple comparisons (uncorrected Dunn’s test); and (2) to perform Fisher’s exact test with Bonferroni correction for pie chart distributions. For cell and domain area analysis, Microsoft Excel was used to perform paired and unpaired t-tests and to plot standard errors.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

A common type of ant in Europe breaks a fundamental rule in biology: its queens can produce male offspring that are a whole different species. These queen Iberian harvester ants (Messor ibericus) are sexual parasites that rely on the sperm of males of the ant species Messor structor. They use this sperm to breed an army of robust worker ants, which are hybrids of the two species.

Data now show that, in the absence of nearby M. structor colonies, M. ibericus queens can clone male M. structor ants by laying eggs that contain only M. structor DNA in their nuclei. The findings were published in Nature on 3 September¹.

“It’s an absolutely fantastic, bizarre story of a system that allows things to happen that seem almost unimaginable,” says Jacobus Boomsma, an evolutionary biologist at the University of Copenhagen.

DIY cloning

Iberian harvester ants co-exist with M. structor in some parts of Europe, which has historically given M. ibericus queens an abundant supply of M. structor males to mate with.

Pupating ants make milk — and scientists only just noticed

But evolutionary biologist Jonathan Romiguier at the Institute of Evolutionary Science of Montpellier in France and his colleagues noticed something strange on the Italian island of Sicily: they found Iberian harvester ants everywhere but not a single colony of M. structor.

When the researchers peered inside colonies of the Iberian harvester ant, they found two types of ant that looked very different. Genetic analyses confirmed that the colonies contained both M. ibericus and M. structor, despite the lack of M. structor populations on the island.

Further analyses solved the mystery: Iberian harvester queens clone M. structor ants to maintain a supply of their sperm. They then mate with those M. structor ants to produce hybrid workers that take care of the colony, including by building the nest and foraging for food. In effect, M. ibericus has domesticated M. structor and its genome, Romiguier says.

CAPE CANAVERAL, Fla. — Scientists revealed Wednesday that Mars’ innermost core appears to be a solid hunk of metal just like Earth’s.

The Chinese-led research team based their findings on seismic readings from NASA’s InSight lander on Mars, which recorded more than 1,300 marsquakes before shutting down in 2022. The spacecraft landed on a broad plain near Mars’ equator in 2018.

Previous studies pointed to liquid at the heart of the red planet. The latest findings indicate the inner core, while small, is indeed solid and surrounded by molten metal — a liquid outer core.

The Martian inner core extends from the planet’s center out to a radius of approximately 380 miles (613 kilometers), according to the scientists whose findings appeared in the journal Nature.

It’s likely composed of iron and nickel, the same ingredients as Earth’s core, but quite possibly also enriched with lighter elements like oxygen.

Mars’ liquid outer core is bigger, stretching from 380 miles (613 kilometers) to as much as 1,100 miles (1,800 kilometers) from the planet’s center.

Crystallization of Mars’ inner core may have occurred in the past and still be occurring today, one of the lead investigators, Daoyuan Sun of the University of Science and Technology of China, said in an email.

Mars’ core initially would have been entirely liquid. It’s unclear whether the liquid outer core contains any solid material like droplets or whether there might be “a mushy zone” near the boundary between the inner and outer cores, he added.

For their study, Sun and his team relied primarily on 23 marsquakes recorded by InSight, all of them relatively weak. The epicenters were 740 miles to 1,465 miles (1,200 kilometers to 2,360 kilometers) away from the lander.

“Our results suggest that Mars has a solid inner core making up about one-fifth of the planet’s radius — roughly the same proportion as Earth’s inner core. However, this similarity may be just coincidental,” Sun said.

While praising the results, the University of Maryland’s Nicholas Schmerr, who was not involved in the study, said questions regarding Mars’ core are far from settled. With InSight out of action, there will be no new recordings of marsquakes to further reveal the red planet’s insides, he noted.

“There are a lot of details about the exact shape of the inner core and composition of the inner and outer core of Mars that will require a network of InSight like seismometer stations to resolve,” Schmerr said in an email.

More detailed modeling is necessary to develop a clearer picture of how the inner core formed and “what it reveals about the history of Mars’ magnetic field,” said Sun.

At present, Mars lacks a magnetic field, possibly because of the slow crystallization of the planet’s solid core, Schmerr added.

___

The Associated Press Health and Science Department receives support from the Howard Hughes Medical Institute’s Department of Science Education and the Robert Wood Johnson Foundation. The AP is solely responsible for all content.