- PacBio Announces Preliminary Fourth Quarter and Full Year 2025 Revenue PacBio
- PACB Forecasts Strong FY25 Revenue as Sales Gain Traction GuruFocus
- Here’s Why You Should Add PacBio Stock to Your Portfolio Nasdaq
- PacBio Announces Strong Preliminary Q4 and 2025 Revenue TipRanks
- PacBio Reports Preliminary Unaudited Q4 and Full Year 2025 Revenue Growth Quiver Quantitative
Category: 3. Business
-
PacBio Announces Preliminary Fourth Quarter and Full Year 2025 Revenue – PacBio
-
Project management tool stops working at start of work week
Trello down Project management tool stops working at start of work week In an unfortunate development for workplaces, the popular project management tool Trello is not working, reportedly, after an outage hit it just at the beginning of the work week.
As reported by users, the outage primarily affected the Trello app, which is designed to help teams track project progress through a system of cards.
Trello’s downtime began early on Monday, with users experiencing crashes and error messages. Upon refreshing, they were shown notifications such as “You are disconnected” or “We’re having trouble loading Trello.”
This disruption has left countless professionals unable to access Trello, which is primarily used on web.
Trello not working, but status update says otherwise
The interesting part is that Trello’s official status page did not indicate any active incidents, showing “No incidents reported today” and listing all systems as “Operational.” This discrepancy has added to users’ confusion regarding the outage.
Those unfamiliar should note that Trello is widely utilised in workplace settings, enabling collaborative work on various projects, but it can also be adapted for personal tasks, like home renovations.
With service downtime in place, users are advised to refrain from heavy editing, refresh their pages, and attempt to access their boards later when the service is fully stabilised.
Why Trello is not working?
The exact cause of the outage remains unclear, but Trello is expected to be back up with functionality restored for users, allowing them to resume their projects in an unperturbed manner.
Continue Reading
-
Methane Regulator-to-Regulator Network | Climate & Clean Air Coalition
The Methane Regulator-to-Regulator (MR2R) Network is a peer-to-peer platform created by the Climate and Clean Air Coalition (CCAC) and the International Energy Agency (IEA) to help fossil fuel regulators share experience, develop best practices, and strengthen methane regulation through trusted collaboration.
About the Network
The Methane Regulator-to-Regulator (MR2R) Network is designed for government regulators responsible for methane emissions from the oil, gas, and coal sectors. As countries implement commitments under the Global Methane Pledge and respond to rising expectations for low-emissions energy, regulators are increasingly required to design and enforce new methane frameworks, often with limited access to peers or tested regulatory models.
The MR2R Network, established by the Climate and Clean Air Coalition (CCAC) and the International Energy Agency (IEA) through the CCAC Fossil Fuel Hub and the IEA’s Global Methane Engagement Programme, provides a trusted, closed-door environment where regulators can connect, learn, and collaborate. The network complements the Fossil Fuel Regulatory Programme (FFRP) and builds on the IEA’s regional roundtables by focusing specifically on practical regulatory exchange.
Through MR2R, regulators can engage in continuous dialogue with peers at different stages of the regulatory journey, share real-world experiences, discuss challenges, and co-develop solutions to accelerate the effective design and implementation of methane regulations. The network supports regulators through activities such as annual in-person meetings, technical webinars, mentorships, panel participation, co-authored publications, and a rapid peer-support hotline, enabling members to strengthen regulatory capacity and leadership in methane abatement.
About the CCAC and IEA
The Climate and Clean Air Coalition (CCAC) is a global partnership working to reduce short-lived climate pollutants, including methane, in order to protect the climate and improve air quality.
The International Energy Agency (IEA) is the world’s leading authority on global energy data, analysis, and policy.
The MR2R Network is jointly delivered by the CCAC Fossil Fuel Hub and the IEA’s Global Methane Engagement Programme. CCAC leads coordination with governments and alignment with the Fossil Fuel Regulatory Programme (FFRP), while the IEA provides technical analysis, regulatory expertise, and support through its existing regulatory roundtables. Together, they co-convene the network, support its activities, and ensure it delivers practical value to participating regulators.
Continue Reading
-
Johnson Controls announces first quarter 2026 Earnings Conference Call Webcast
CORK, Ireland, Jan. 12, 2026 /PRNewswire/ -- Johnson Controls International plc (NYSE: JCI), the global leader for smart, healthy and sustainable buildings, announces the following webcast:
What: Johnson Controls First Quarter Fiscal 2026 Earnings Conference Call
When: Wednesday, Feb. 4, 2026, at 8:30 a.m. ET
How: The conference call for investors can be accessed in the following ways:
- Live via webcast at http://investors.johnsoncontrols.com/news-and-events/events-and-presentations Note: A slide presentation will be available that morning for downloading.
- Live via telephone (for "listen-only" participants and those who would like to ask a question) by dialing 855-979-6654 (in the United States) or +1-646-233-4753 (outside the United States) along with passcode 927389.
Replay: The replay can be accessed in the following ways:
- Replay via webcast – if you are unable to participate during the live webcast, the call will be archived at http://investors.johnsoncontrols.com/news-and-events/events-and-presentations.
- Replay via telephone – by dialing 855-762-8306 (in the United States) or +1-845-709-8569 (outside the United States), passcode 547602, from 10:30 a.m. (ET) on Feb. 4, 2026, until 11:59 p.m. (ET) on Feb. 18, 2026.
About Johnson Controls
At Johnson Controls (NYSE:JCI), we transform the environments where people live, work, learn and play. As the global leader in smart, healthy and sustainable buildings, our mission is to reimagine the performance of buildings to serve people, places and the planet.
Building on a proud history of 140 years of innovation, we deliver the blueprint of the future for industries such as healthcare, schools, data centers, airports, stadiums, manufacturing and beyond through OpenBlue, our comprehensive digital offering.
Today, Johnson Controls offers the world`s largest portfolio of building technology and software as well as service solutions from some of the most trusted names in the industry.
Visit johnsoncontrols.com for more information and follow @Johnsoncontrols on social platforms.
SOURCE Johnson Controls International plc
Continue Reading
-
Danaher CEO to Comment on Financial Performance
WASHINGTON, Jan. 12, 2026 /PRNewswire/ — Danaher Corporation (NYSE: DHR) (the “Company”) announced that its President and Chief Executive Officer, Rainer M. Blair, will comment tomorrow on the Company’s fourth quarter 2025 performance in a presentation at the J.P. Morgan Healthcare Conference at 11:15 a.m. PT.
- For the fourth quarter 2025, estimated revenues are anticipated to increase in the mid-single digit percent range year-over-year.
- Estimated non-GAAP core revenue growth for the fourth quarter of 2025 is expected to be toward the high-end of our previously announced low-single digit percentage guidance.
- For the full year 2025, anticipated non-GAAP adjusted diluted net earnings per common share is expected to be toward the high-end of our previously announced guidance range of $7.70 to $7.80.
Rainer M. Blair, President and Chief Executive Officer, stated, “Our team executed well to deliver a solid finish to 2025. We were especially pleased with continued strength in Bioprocessing and better-than-expected Life Sciences and Diagnostics revenue in the fourth quarter.”
Mr. Blair continued, “We believe the combination of our differentiated portfolio, the power of the Danaher Business System and the strength of our balance sheet position Danaher for long-term value creation as we move into 2026 and beyond.”
The event will be simultaneously webcast and can be accessed on the “Investors” section of Danaher’s website, www.danaher.com, under the subheading “Events & Presentations.”
As previously announced, Danaher will hold its quarterly earnings conference call for the fourth quarter and full year 2025 on Wednesday, January 28, 2026 at 8:00 a.m. ET.
ABOUT DANAHER
Danaher is a leading global life sciences and diagnostics innovator, committed to accelerating the power of science and technology to improve human health. Our businesses partner closely with customers to solve many of the most important health challenges impacting patients around the world. Danaher’s advanced science and technology – and proven ability to innovate – help enable faster, more accurate diagnoses and help reduce the time and cost needed to sustainably discover, develop and deliver life-changing therapies. Focused on scientific excellence, innovation and continuous improvement, our approximately 63,000 associates worldwide help ensure that Danaher is improving quality of life for billions of people today, while setting the foundation for a healthier, more sustainable tomorrow. Explore more at www.danaher.com.
SUPPLEMENTAL MATERIAL
A calculation of core revenue growth, an explanation of what the measure represents and the reasons why we believe this measure provides useful information to investors, a reconciliation of the measure to the most directly comparable GAAP measure and other information relating to the non-GAAP measure are included in the supplemental reconciliation schedule attached.
In addition, this earnings release (including the supplemental reconciliation schedule) and a note containing details of Danaher’s estimated 2025 financial performance have been posted to the “Investors” section of Danaher’s website (www.danaher.com).
FORWARD-LOOKING STATEMENTS
Statements in this release that are not strictly historical, including the statements regarding the Company’s estimated financial results for the fourth quarter and full year 2025, Danaher’s competitive positioning for long-term value creation, and any other statements regarding events or developments that we believe or anticipate will or may occur in the future are “forward-looking” statements within the meaning of the federal securities laws. There are a number of important factors that could cause actual results, developments and business decisions to differ materially from those suggested or indicated by such forward-looking statements and you should not place undue reliance on any such forward-looking statements. These factors include, among other things: the impact of tariffs and related actions implemented by the U.S. and other countries, the impact of our debt obligations on our operations and liquidity, deterioration of or instability in the global economy, the markets we serve and the financial markets, uncertainties with respect to the development, deployment, and use of artificial intelligence in our business and products, the impact of global health crises, uncertainties relating to national laws or policies, including laws or policies to protect or promote domestic interests and/or address foreign competition, contractions or growth rates and cyclicality of markets we serve, competition, our ability to develop and successfully market new products and technologies and expand into new markets, the potential for improper conduct by our employees, agents or business partners, our compliance with applicable laws and regulations (including rules relating to off-label marketing and other regulations relating to medical devices and the healthcare industry), the results of our clinical trials and perceptions thereof, our ability to effectively address cost reductions and other changes in the healthcare industry, our ability to successfully identify and consummate appropriate acquisitions and strategic investments, our ability to integrate the businesses we acquire and achieve the anticipated growth, synergies and other benefits of such acquisitions, contingent liabilities and other risks relating to acquisitions, investments, strategic relationships and divestitures (including tax-related and other contingent liabilities relating to past and future IPOs, split-offs or spin-offs), security breaches or other disruptions of our information technology systems or violations of data privacy laws, the impact of our restructuring activities on our ability to grow, risks relating to potential impairment of goodwill and other intangible assets, currency exchange rates, tax audits and changes in our tax rate and income tax liabilities, changes in tax laws applicable to multinational companies, litigation, regulatory proceedings and other contingent liabilities including intellectual property and environmental, health and safety matters, the rights of the United States government with respect to our production capacity in times of national emergency or with respect to intellectual property/production capacity developed using government funding, risks relating to product, service or software defects, product liability and recalls, risks relating to our manufacturing operations, the impact of climate change, legal or regulatory measures to address climate change and other sustainability topics and our ability to address regulatory requirements or stakeholder expectations relating to climate change and other sustainability topics, risks relating to fluctuations in the cost and availability of the supplies we use (including commodities) and labor we need for our operations, our relationships with and the performance of our channel partners, uncertainties relating to collaboration arrangements with third-parties, the impact of deregulation on demand for our products and services, labor matters and our ability to recruit, retain and motivate talented employees, U.S. and non-U.S. economic, political, geopolitical, legal, compliance, social and business factors (including the impact of elections, regulatory changes or uncertainty, government shutdowns and military conflicts), disruptions and other impacts relating to man-made and natural disasters, inflation and the impact of our By-law exclusive forum provisions. Additional information regarding the factors that may cause actual results to differ materially from these forward-looking statements is available in our SEC filings, including our 2024 Annual Report on Form 10-K and Quarterly Report on Form 10-Q for the third quarter of 2025. These forward-looking statements speak only as of the date of this release and except to the extent required by applicable law, the Company does not assume any obligation to update or revise any forward-looking statement, whether as a result of new information, future events and developments or otherwise.
Estimated Sales Growth and Core Sales Growth
% Estimated Change Three-Month
Period Ended December 31, 2025
vs. Comparable 2024 PeriodTotal sales growth (GAAP)
+Mid-single digit
Impact of:
Acquisitions/divestitures
+Up slightly
Currency exchange rates
-Low-single digit
Core sales growth (non-GAAP)
+Low-single digit
Statement Regarding Non-GAAP Measures
Core sales growth should be considered in addition to, and not as a replacement for or superior to, sales growth, and may not be comparable to similarly titled measures reported by other companies. Management believes that this measure provides useful information to investors by offering additional ways of viewing Danaher Corporation’s (“Danaher” or the “Company”) results that, when reconciled to sales growth, help our investors identify underlying growth trends in our business and compare our sales performance with prior and future periods and to our peers.
Management uses core sales growth to measure the Company’s operating and financial performance, and uses core sales growth as one of the performance measures in the Company’s executive compensation program.
With respect to this non-GAAP measure, we exclude (1) the impact of currency translation because it is not under management’s control, is subject to volatility and can obscure underlying business trends, and (2) the effect of acquisitions and divested product lines because the timing, size, number and nature of such transactions can vary dramatically from period-to-period and between us and our peers, which we believe may obscure underlying business trends and make comparisons of long-term performance difficult.
SOURCE Danaher Corporation
For further information: John T. Bedford, Vice President, Investor Relations, investor.relations@danaher.com, Danaher Corporation, 2200 Pennsylvania Avenue, N.W., Suite 800W, Washington, D.C. 20037, Telephone: (202) 828-0850, Fax: (202) 828-0860
Continue Reading
-
G7 Cyber Expert Group Releases Roadmap for Coordinating the Transition to Post-Quantum Cryptography in the Financial Sector
The G7 Cyber Expert Group (CEG) – chaired by the U.S. Department of the Treasury and the Bank of England – released a public statement today advising financial entities, authorities and suppliers of key considerations and potential activities for transitioning to quantum-resilient technology in a coordinated and timely way.
Quantum computers have the potential to revolutionize the financial sector, unlocking significant new capabilities and opportunities for organizations. This is not without risk however – sufficiently advanced quantum computers have the potential to break widely used cryptographic protocols that protect our systems and data.
G7 CEG Co-Chairs, U.S. Treasury’s Deputy Assistant Secretary for Cybersecurity and Critical Infrastructure Protection Cory Wilson and the Bank of England’s Executive Director for Supervisory Risk Duncan Mackinnon, said:
“The introduction of quantum computers that can break our encryption tools presents a significant risk to the safety and soundness of our financial ecosystem. This is something we must address together, and the roadmap guidance will be an important reference for organizations to consider as they prepare their systems and data to be quantum resilient.”
The G7 CEG’s roadmap outlines several considerations for financial sector stakeholders, authorities and industry about the cryptographic risks associated with quantum computers. The roadmap and its associated timeline are not prescriptive, providing organizations with the flexibility to implement as appropriate for their unique situation.
The G7 CEG’s membership includes representatives of financial authorities across all G7 countries as well as the European Union. It was founded in 2015 to serve as a multi-year working group that coordinates cybersecurity policy and strategy across the member jurisdictions. In addition to policy coordination, the G7 CEG also acts as a vehicle for information sharing, cooperation, and incident response.
Continue Reading
-
Response to ‘Towards an individualized strategy in perioperative chemotherapy for pancreatic cancer’
TFS: Conception of project, data analysis, interpretation of results, writing the manuscript; YHAW: Conception of project, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; AO: Conception of project, acquired data, interpretation of results, revised the manuscript, approved the final version; MA: Conception of project, data analysis, interpretation of results, writing the manuscript, revised the manuscript, approved the final version; WM: Conception of project, revised the manuscript, approved the final version; MGB: Conception of project, revised the manuscript, approved the final version, supervision; RAB: Conception of project, revised the manuscript, approved the final version, supervision; JWW: Conception of project, revised the manuscript, approved the final version, supervision; MDC: Conception of project, revised the manuscript, approved the final version, supervision. All coauthors meet the following criteria: 1. Conceived and/or designed the work that led to the submission, acquired data, and/or played an important role in interpreting the results. 2. Drafted or revised the manuscript. 3. Approved the final version. 4. Agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Continue Reading
-
Dilated cardiomyopathy-associated RNA-binding motif protein 20 regulates long pre-mRNAs in neurons
The CLIP experiments were performed according to the seCLIP protocol (Van Nostrand et al., 2017a) with some minor modifications (Traunmüller et al., 2023). Olfactory bulbs from seven mice were pooled for each biological replicate, and for heart tissue, one heart was used per biological replicate. Samples were flash-frozen and ground on dry ice first in a metal grinder and a porcelain mortar. The frozen powder was transferred into a plastic Petri dish and distributed in a thin layer. The samples were UV-cross-linked three times at 400 mJ/cm2 on dry ice with a UV-cross-linker (Cleaver Scientific). The powder was mixed and redistributed on the Petri dish before each UV exposure. After cross-linking, the powder was collected in 3.5 ml (olfactory bulbs) or 5.5 ml (heart) in lysis buffer (50 mM Tris-HCl pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, complete protease inhibitors, Roche) and 4 U/ml Turbo-DNase (Thermo Fisher). Samples were further processed as described in detail below.
For the clip samples preparation, the lysate was transferred into a glass homogenizer and homogenized by 30 strokes on ice. 1 ml aliquots of homogenized tissue were transferred to 2 ml tubes, 10 µl of RNaseI (Thermo Fisher) diluted in PBS (1:5–1:40) were added to each tube. Samples were incubated at 37°C with shaking for 5 min at 1200× rpm and then put on ice. 10 µl RNasin RNase inhibitor (40 U/µl, Promega) was added to each tube. Samples were mixed and centrifuged at 16,000 × g for 15 min at 4°C. The supernatants were transferred to a new tube, and 60 µl from each sample was taken and further processed for sized-matched INPUT (SMIn). 10 µl HA-magnetic beads (Pierce) was added to each sample and incubated at 4°C for 4 hr in a rotating shaker. Following incubation, the beads were washed 2× with a high salt wash buffer (50 mM Tris-HCl pH 7.5, 1 M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate), 2× with the lysis buffer, 2× with low salt wash buffer (20 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.2% Tween-20) and 1× with PNK buffer (70 mM Tris-HCl pH 6.5, 10 mM MgCl2). Beads were resuspended in 100 µl PNK mix (70 mM Tris-HCl pH 6.5, 10 mM MgCl2, 1 mM DTT, 100 U RNasin, 1 U TurboDNase, 25 U Polynucleotide-Kinase [NEB]) and incubated at 37°C for 20 min on a shaking termomixer (1200× rpm). Upon RNA dephosphorylation, the beads were washed (2× high salt, 2× lysis, and 2× low salt buffers as before) and additionally with 1× Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2). Beads were then resuspended in 50 µl ligase mix (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 3% DMSO, 15% PEG8000, 30 U RNasin, 75 U T4 RNA-ligase [NEB]). 10 µl of the beads/ligase mix was transferred to a new tube, and 1 µl of pCp-Biotin (Jena Bioscience) was added to validate IP of the RNA-protein complexes by western blot. 4 µl of the RNA-adaptor mix containing 40 µM of each InvRiL19 & InvRand3Tr3 (IDT) was added to the remaining of the samples (40 µl). Samples were incubated at room temperature for 2 hr for adaptor ligation. Samples were washed 2× with high salt, 2× with lysis, and 1× with low salt buffers. Finally, beads were resuspended in 1× LDS sample buffer (Thermo Fisher) supplemented with 10 µM DTT and incubated for 10 min at 65°C, shaking on a thermomixer at 1200× rpm. Eluates or inputs were loaded on 4–12% Bis-Tris, 1.5 mm gel (Thermo Fisher) and separated at 130 V for ~1.5 hr. Proteins were transferred overnight at 30 V to a nitrocellulose membrane (Amersham). The membranes were placed in a 15 cm Petri dish on ice, and an area between 55 and 145 kDa was cut out into small pieces and transferred into a 2 ml tube.
RNA extraction, reverse transcription using InvAR17 primer, cDNA clean-up using silane beads (Thermo Fisher), second adaptor ligation (InvRand3Tr3), and cDNA purification steps were performed as previously described (Van Nostrand et al., 2016). The sequencing libraries were amplified using Q5-DNA polymerase (NEB) and i50X/i70X Illumina indexing primers (IDT). Final libraries were amplified with 14 cycles. Libraries were purified and concentrated with ProNEX size-selective purification system (Promega) using sample/beads ratio of 1/2.4. Samples were loaded on a 2% agarose gel, and the area corresponding to the size between 175 and 350 bp was cut out. The amplified and purified libraries were then extracted from the gel using a gel extraction kit (Machery&Nagel) and eluted with 16 µl.
The concentrations and the size distributions of the libraries were determined on the Fragment Analyzer system (Agilent). 75 bp single-end sequencing was performed on the NextSeq500 platform using Mid Output Kit v2.5 (75 cycles).
Adaptor and primer sequences used in this study:
Name Sequence InvRi L19 /5Phos/rArGrArUrCrGrGrArArGrArGrCrArCrA rCrGrUrC/3SpC3/ InvRand3Tr3 /5Phos/NNNNNNNNNNAGATCGGAAGA GCGTCGTGT/3SpC3/ InvA R17 CAGACGTGTGCTCTTCCGA i501 AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i502 AATGATACGGCGACCACCGAGATCTACACATAGAGGCACACTCTTTCCCTACACGACGCTCTTCCGATC*T i503 AATGATACGGCGACCACCGAGATCTACACCCTATCCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T i504 AATGATACGGCGACCACCGAGATCTACACGGCTCTGAACACTCTTTCCCTACACGACGCTCTTCCGATC*T i701 CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i702 CAAGCAGAAGACGGCATACGAGATTCTCCGGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i703 CAAGCAGAAGACGGCATACGAGATAATGAGCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T i704 CAAGCAGAAGACGGCATACGAGATGGAATCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T X* = Phosphorthioated base
seCLIP data processing was performed as described (Van Nostrand et al., 2016; Van Nostrand et al., 2017b; Van Nostrand et al., 2020). In brief, raw reads were processed to obtain unique CLIP tags mapped to mm10 using Clipper (https://github.com/YeoLab/clipper ; Lovci et al., 2025; https://github.com/YeoLab/eclip ; Yee and Domissy, 2022). Reads from replicates 1 and 2 from the olfactory bulb were concatenated. Peak normalization was performed by processing the SMInput samples using the same peak calling pipeline. Irreproducible discovery rate (IDR) analysis was performed to identify reproducible peaks across biological replicates (Li et al., 2011). IDR (https://github.com/nboley/idr; Boley, 2017) was used to rank seCLIP peaks by the fold change over the size-matched input. Clip peaks were called based on IDR<0.05. We observed some short highly represented sequences that were not specific to RBM20 seCLIP isolations, which were excluded based on peak shape and width (<30 bp) using StoatyDive (Heyl and Backofen, 2021).
For motif discovery, cross-link-induced truncation sites (CITS) were called using the CTK pipeline (Shah et al., 2017). Briefly, unique tags from replicates were combined, and CITS were called by requiring FDR<0.001. Sequences from –10 bp to +10 bp from called CITS were used as input sequences for DREME software (Bailey et al., 2009; Bailey et al., 2015; Nystrom and McKay, 2021). As a control, sequences of the same length located 500 bp upstream of the CITS site (–510 to –490 bases) were used. Enrichment of the UCUU motif at the CITS sites was calculated.
Continue Reading
-
Google scraps AI Overviews for certain medical queries: Find out why
Google scraps AI Overviews for certain medical queries: Find out why Following an investigation by a prominent news outlet that found misleading information in Google’s AI Overviews for health-related searches, the search giant has removed the AI-assisted summaries for health-specific queries.
The investigation found that asking “what is the normal range for liver blood tests” yielded results that failed to consider crucial factors such as age, sex, ethnicity, and nationality. It is suspected that this omission might lead users to misinterpret their health results.
The Guardian reported that AI Overviews have been eliminated for queries like “what is the normal range for liver blood tests” and “what is the normal range for liver function tests.” However, variations of the same queries, such as “lft reference range,” are still offering AI summaries.
As reported by TechCrunch, there were no AI Overviews upon testing these queries shortly after the Guardian’s report, although Google still provided an option to ask in AI Mode.
The interesting twist is: the top result often directed users to the Guardian’s article discussing the removal.
The company does not comment on specific removals but is committed to making meaningful improvements, a Google spokesperson was quoted as saying.
They noted that Google’s internal health experts reviewed the queries in question and found that the information was not necessarily inaccurate and was supported by reputable sources.
Vanessa Hebditch, the director of communications and policy at the British Liver Trust, cherished the removal but expressed concern that this action addresses only a single issue rather than AI Overviews’ wider implications in health-related searches.
Continue Reading
-
S&P Global Completes Sale of EDM and thinkFolio Businesses
NEW YORK, Jan. 12, 2026 /PRNewswire/ — S&P Global (NYSE: SPGI) today announced it has completed the sale of its EDM and thinkFolio businesses to STG, a private equity firm focused on building and scaling market-leading software, data and analytics companies.
The transaction, which was announced in October 2025, does not have material impact to S&P Global financials. Financial terms were not disclosed. Local closings in certain jurisdictions are expected to occur over the following few months.
Barclays acted as financial advisor and Skadden, Arps, Slate, Meagher & Flom LLP acted as legal advisor to S&P Global on the transaction.
Media Contacts:
Orla O’Brien
S&P Global
+1 857 407 8559
orla.obrien@spglobal.comErina Aoyama
S&P Global Market Intelligence
+1 917 755 7943
erina.aoyama@spglobal.comAbout S&P Global:
S&P Global (NYSE: SPGI) provides essential intelligence. We enable governments, businesses and individuals with the right data, expertise, and connected technology so that they can make decisions with conviction. From helping our customers assess new investments to guiding them through sustainability and energy transition across supply chains, we unlock new opportunities, solve challenges, and accelerate progress for the world.
We are widely sought after by many of the world’s leading organizations to provide credit ratings, benchmarks, analytics and workflow solutions in the global capital, commodity, and automotive markets. With every one of our offerings, we help the world’s leading organizations plan for tomorrow and today. For more information, visit www.spglobal.com.
SOURCE S&P Global
Continue Reading